Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632240_at:

>probe:Drosophila_2:1632240_at:279:505; Interrogation_Position=1593; Antisense; GTCCACCGGCAGGTCGAAGTCAAAT
>probe:Drosophila_2:1632240_at:596:171; Interrogation_Position=1622; Antisense; AAAGAGCATCGATGGAGCGCAGTGA
>probe:Drosophila_2:1632240_at:722:521; Interrogation_Position=1664; Antisense; GGGCCACGTAGCTGTCTGCTGAGTA
>probe:Drosophila_2:1632240_at:548:641; Interrogation_Position=1678; Antisense; TCTGCTGAGTAGTACGTGTCCACCA
>probe:Drosophila_2:1632240_at:84:517; Interrogation_Position=1693; Antisense; GTGTCCACCAGTTCATGGCAGCTGA
>probe:Drosophila_2:1632240_at:487:607; Interrogation_Position=1715; Antisense; TGAGGATCAGGTTCAGCCACTCCAC
>probe:Drosophila_2:1632240_at:204:311; Interrogation_Position=1802; Antisense; GCCAAGGTAAAGGTCTATCCCCGCG
>probe:Drosophila_2:1632240_at:358:327; Interrogation_Position=1824; Antisense; GCGTCCCTGTTAGCCTTATGCTTAA
>probe:Drosophila_2:1632240_at:699:341; Interrogation_Position=1843; Antisense; GCTTAAATTAATTCGGCAGACTGCA
>probe:Drosophila_2:1632240_at:558:171; Interrogation_Position=1867; Antisense; AAAGTCAAAAGCTACCTGCACCTAG
>probe:Drosophila_2:1632240_at:342:363; Interrogation_Position=1984; Antisense; GAATTGACATTACCGCAGAATTGCT
>probe:Drosophila_2:1632240_at:192:183; Interrogation_Position=2055; Antisense; AAAAGTTTGTGTGTCTCTTGCTCTT
>probe:Drosophila_2:1632240_at:258:339; Interrogation_Position=2074; Antisense; GCTCTTTAAGATTCCTCTTTGCCAG
>probe:Drosophila_2:1632240_at:44:343; Interrogation_Position=2143; Antisense; GCTTCAAACTATGCACCTGTAAATA

Paste this into a BLAST search page for me
GTCCACCGGCAGGTCGAAGTCAAATAAAGAGCATCGATGGAGCGCAGTGAGGGCCACGTAGCTGTCTGCTGAGTATCTGCTGAGTAGTACGTGTCCACCAGTGTCCACCAGTTCATGGCAGCTGATGAGGATCAGGTTCAGCCACTCCACGCCAAGGTAAAGGTCTATCCCCGCGGCGTCCCTGTTAGCCTTATGCTTAAGCTTAAATTAATTCGGCAGACTGCAAAAGTCAAAAGCTACCTGCACCTAGGAATTGACATTACCGCAGAATTGCTAAAAGTTTGTGTGTCTCTTGCTCTTGCTCTTTAAGATTCCTCTTTGCCAGGCTTCAAACTATGCACCTGTAAATA

Full Affymetrix probeset data:

Annotations for 1632240_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime