FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632241_at:

>probe:Drosophila_2:1632241_at:413:183; Interrogation_Position=1849; Antisense; AAAATGACCGTGATGGGCACCTCCG
>probe:Drosophila_2:1632241_at:347:17; Interrogation_Position=1946; Antisense; ATTTAGTGGACTGCCTCAATGATGC
>probe:Drosophila_2:1632241_at:688:385; Interrogation_Position=1981; Antisense; GAACATATCGCCGTTGCTGTTTCCA
>probe:Drosophila_2:1632241_at:78:481; Interrogation_Position=1999; Antisense; GTTTCCAGACAGCACTCTTTTTACA
>probe:Drosophila_2:1632241_at:333:709; Interrogation_Position=2019; Antisense; TTACAATCCCCGAATCCAACGAGAT
>probe:Drosophila_2:1632241_at:409:199; Interrogation_Position=2036; Antisense; AACGAGATCGTCTCTACTGCTTCGA
>probe:Drosophila_2:1632241_at:87:319; Interrogation_Position=2063; Antisense; GCCGAGAATCCCTGTATGTCTATTT
>probe:Drosophila_2:1632241_at:64:19; Interrogation_Position=2084; Antisense; ATTTGGTTACCATGCTACTGCCGAA
>probe:Drosophila_2:1632241_at:451:317; Interrogation_Position=2103; Antisense; GCCGAAGAAGTACCATTTGCTGCAC
>probe:Drosophila_2:1632241_at:443:221; Interrogation_Position=2176; Antisense; AAGTGGGCACGCGATCTGGACATGC
>probe:Drosophila_2:1632241_at:440:51; Interrogation_Position=2197; Antisense; ATGCGACGCATGATCCACGAGGAGA
>probe:Drosophila_2:1632241_at:180:109; Interrogation_Position=2235; Antisense; AGAAGATCCTTTCAAGGCTCTCACC
>probe:Drosophila_2:1632241_at:457:71; Interrogation_Position=2249; Antisense; AGGCTCTCACCTTTGATCAGTTTCG
>probe:Drosophila_2:1632241_at:110:721; Interrogation_Position=2324; Antisense; TTGCCTTCGAGTTGTGCTACGTTAA

Paste this into a BLAST search page for me
AAAATGACCGTGATGGGCACCTCCGATTTAGTGGACTGCCTCAATGATGCGAACATATCGCCGTTGCTGTTTCCAGTTTCCAGACAGCACTCTTTTTACATTACAATCCCCGAATCCAACGAGATAACGAGATCGTCTCTACTGCTTCGAGCCGAGAATCCCTGTATGTCTATTTATTTGGTTACCATGCTACTGCCGAAGCCGAAGAAGTACCATTTGCTGCACAAGTGGGCACGCGATCTGGACATGCATGCGACGCATGATCCACGAGGAGAAGAAGATCCTTTCAAGGCTCTCACCAGGCTCTCACCTTTGATCAGTTTCGTTGCCTTCGAGTTGTGCTACGTTAA

Full Affymetrix probeset data:

Annotations for 1632241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720