FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632243_at:

>probe:Drosophila_2:1632243_at:136:431; Interrogation_Position=1344; Antisense; GAGTGCCAGGGATTCTTTAGCTATC
>probe:Drosophila_2:1632243_at:697:721; Interrogation_Position=1470; Antisense; TTGGTTCCGCGGTCCAAGAAAGTGC
>probe:Drosophila_2:1632243_at:455:169; Interrogation_Position=1488; Antisense; AAAGTGCGTCTGGATGGCGTCGACT
>probe:Drosophila_2:1632243_at:490:575; Interrogation_Position=1503; Antisense; GGCGTCGACTACTTTAGCATAGACA
>probe:Drosophila_2:1632243_at:378:1; Interrogation_Position=1528; Antisense; TTAAGGGCCTAATCCTACCTACATT
>probe:Drosophila_2:1632243_at:312:425; Interrogation_Position=1581; Antisense; GAGACGCGCCAGATGTTTAGCTCCA
>probe:Drosophila_2:1632243_at:16:229; Interrogation_Position=1641; Antisense; AAGGCCACCCAAAAGCTGCTTGAAA
>probe:Drosophila_2:1632243_at:93:207; Interrogation_Position=1653; Antisense; AAGCTGCTTGAAACTCCGGAGACGC
>probe:Drosophila_2:1632243_at:349:79; Interrogation_Position=1714; Antisense; AGGTCTTTGGCGAGCAGAATCTTTC
>probe:Drosophila_2:1632243_at:258:239; Interrogation_Position=1731; Antisense; AATCTTTCGGAGTGTGGTCTGCTGC
>probe:Drosophila_2:1632243_at:501:579; Interrogation_Position=1785; Antisense; GGCCAACATGCCGTAGGTCTTTTAG
>probe:Drosophila_2:1632243_at:344:79; Interrogation_Position=1799; Antisense; AGGTCTTTTAGAGCGCGTTTGCTAT
>probe:Drosophila_2:1632243_at:265:147; Interrogation_Position=1872; Antisense; ACTAGAGCAGCTTTGTTTTCCTAAT
>probe:Drosophila_2:1632243_at:241:477; Interrogation_Position=1886; Antisense; GTTTTCCTAATCTGTACGTCTGTTA

Paste this into a BLAST search page for me
GAGTGCCAGGGATTCTTTAGCTATCTTGGTTCCGCGGTCCAAGAAAGTGCAAAGTGCGTCTGGATGGCGTCGACTGGCGTCGACTACTTTAGCATAGACATTAAGGGCCTAATCCTACCTACATTGAGACGCGCCAGATGTTTAGCTCCAAAGGCCACCCAAAAGCTGCTTGAAAAAGCTGCTTGAAACTCCGGAGACGCAGGTCTTTGGCGAGCAGAATCTTTCAATCTTTCGGAGTGTGGTCTGCTGCGGCCAACATGCCGTAGGTCTTTTAGAGGTCTTTTAGAGCGCGTTTGCTATACTAGAGCAGCTTTGTTTTCCTAATGTTTTCCTAATCTGTACGTCTGTTA

Full Affymetrix probeset data:

Annotations for 1632243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720