FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632246_at:

>probe:Drosophila_2:1632246_at:338:193; Interrogation_Position=433; Antisense; AACGCTGCACTAACCAAGGAGTCGA
>probe:Drosophila_2:1632246_at:661:431; Interrogation_Position=451; Antisense; GAGTCGATGGAGCTTCAATGTCTGA
>probe:Drosophila_2:1632246_at:89:201; Interrogation_Position=494; Antisense; AACGCGCGGCGGACAAACATGCCAT
>probe:Drosophila_2:1632246_at:492:449; Interrogation_Position=628; Antisense; GATCCGGCGATGTTTTTTGACACCA
>probe:Drosophila_2:1632246_at:281:261; Interrogation_Position=648; Antisense; CACCATGTTCAGTGTTTTCTGCGAA
>probe:Drosophila_2:1632246_at:48:377; Interrogation_Position=670; Antisense; GAAGACGTATCAGACCACCAGCAGG
>probe:Drosophila_2:1632246_at:248:535; Interrogation_Position=693; Antisense; GGTGCAGCACTTTAACGAACTCTTC
>probe:Drosophila_2:1632246_at:707:181; Interrogation_Position=718; Antisense; AAAACCTTGCTACATGCCCACATGG
>probe:Drosophila_2:1632246_at:316:153; Interrogation_Position=737; Antisense; ACATGGATCACTACCGGCGACAGCA
>probe:Drosophila_2:1632246_at:579:399; Interrogation_Position=755; Antisense; GACAGCAGCGTGCTCCTCTGATGGA
>probe:Drosophila_2:1632246_at:435:247; Interrogation_Position=851; Antisense; AATTGGATGCCGAGAGCCACGAGCT
>probe:Drosophila_2:1632246_at:564:503; Interrogation_Position=884; Antisense; GTGCCATGAGATATCTAGCCGTCCT
>probe:Drosophila_2:1632246_at:133:675; Interrogation_Position=899; Antisense; TAGCCGTCCTGCGAAAATTGTTCAA
>probe:Drosophila_2:1632246_at:556:629; Interrogation_Position=971; Antisense; TCCTGCAGCACAACTACGAGCTTAT

Paste this into a BLAST search page for me
AACGCTGCACTAACCAAGGAGTCGAGAGTCGATGGAGCTTCAATGTCTGAAACGCGCGGCGGACAAACATGCCATGATCCGGCGATGTTTTTTGACACCACACCATGTTCAGTGTTTTCTGCGAAGAAGACGTATCAGACCACCAGCAGGGGTGCAGCACTTTAACGAACTCTTCAAAACCTTGCTACATGCCCACATGGACATGGATCACTACCGGCGACAGCAGACAGCAGCGTGCTCCTCTGATGGAAATTGGATGCCGAGAGCCACGAGCTGTGCCATGAGATATCTAGCCGTCCTTAGCCGTCCTGCGAAAATTGTTCAATCCTGCAGCACAACTACGAGCTTAT

Full Affymetrix probeset data:

Annotations for 1632246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720