FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632247_at:

>probe:Drosophila_2:1632247_at:417:595; Interrogation_Position=1013; Antisense; TGTGTGGCCTACAGTGGTCGCCCAG
>probe:Drosophila_2:1632247_at:674:263; Interrogation_Position=1035; Antisense; CAGCAATCGATACTTGGCCAGCGGT
>probe:Drosophila_2:1632247_at:465:121; Interrogation_Position=1063; Antisense; AGCGACAACCGCCTGTTGGTTTGGA
>probe:Drosophila_2:1632247_at:605:17; Interrogation_Position=1108; Antisense; ATTTACGCCTTCGACGAGCACAAGG
>probe:Drosophila_2:1632247_at:512:31; Interrogation_Position=1163; Antisense; ATAAGTCCGGTCTTCTGGCCAGTGG
>probe:Drosophila_2:1632247_at:344:631; Interrogation_Position=1203; Antisense; TCGCTGCTTGCGCTTTTGGAACGTC
>probe:Drosophila_2:1632247_at:227:585; Interrogation_Position=1219; Antisense; TGGAACGTCCTCACCGGGAAGCTGG
>probe:Drosophila_2:1632247_at:361:81; Interrogation_Position=1291; Antisense; AGGGATTCCCGAGAGCTGGTTACCA
>probe:Drosophila_2:1632247_at:541:683; Interrogation_Position=1354; Antisense; TATCCCTCGCTGAAGCAGATGGCCA
>probe:Drosophila_2:1632247_at:539:629; Interrogation_Position=1406; Antisense; TCCACCTGTCAGTGAGTCCGGATAA
>probe:Drosophila_2:1632247_at:215:505; Interrogation_Position=1434; Antisense; GTCCATAGTGACTGGCGGCGCAGAT
>probe:Drosophila_2:1632247_at:101:99; Interrogation_Position=1455; Antisense; AGATGAGACGCTTCGCTTCTGGACC
>probe:Drosophila_2:1632247_at:509:631; Interrogation_Position=1516; Antisense; TCCGTGCTCCGTTTGTTTAAAGGCA
>probe:Drosophila_2:1632247_at:657:247; Interrogation_Position=1555; Antisense; AATTGCGACGTATTCTTTGTGCTAC

Paste this into a BLAST search page for me
TGTGTGGCCTACAGTGGTCGCCCAGCAGCAATCGATACTTGGCCAGCGGTAGCGACAACCGCCTGTTGGTTTGGAATTTACGCCTTCGACGAGCACAAGGATAAGTCCGGTCTTCTGGCCAGTGGTCGCTGCTTGCGCTTTTGGAACGTCTGGAACGTCCTCACCGGGAAGCTGGAGGGATTCCCGAGAGCTGGTTACCATATCCCTCGCTGAAGCAGATGGCCATCCACCTGTCAGTGAGTCCGGATAAGTCCATAGTGACTGGCGGCGCAGATAGATGAGACGCTTCGCTTCTGGACCTCCGTGCTCCGTTTGTTTAAAGGCAAATTGCGACGTATTCTTTGTGCTAC

Full Affymetrix probeset data:

Annotations for 1632247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720