FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632250_at:

>probe:Drosophila_2:1632250_at:581:329; Interrogation_Position=169; Antisense; GCGGCACGCCTACAGGAAACGCTAA
>probe:Drosophila_2:1632250_at:19:659; Interrogation_Position=191; Antisense; TAAAGGCCAACGATCCCAACAGCGG
>probe:Drosophila_2:1632250_at:21:213; Interrogation_Position=232; Antisense; AAGACAATGACCCTGGCGGAGGCCC
>probe:Drosophila_2:1632250_at:696:439; Interrogation_Position=250; Antisense; GAGGCCCAGCAGATTCTCGATGTGA
>probe:Drosophila_2:1632250_at:553:633; Interrogation_Position=266; Antisense; TCGATGTGAGTGACCTTACCAACCG
>probe:Drosophila_2:1632250_at:322:457; Interrogation_Position=297; Antisense; GATAGATACGCACTACCAGCACTTG
>probe:Drosophila_2:1632250_at:22:129; Interrogation_Position=311; Antisense; ACCAGCACTTGTTTCGTGTGAACGA
>probe:Drosophila_2:1632250_at:428:613; Interrogation_Position=329; Antisense; TGAACGACAAATCCACCGGCGGTAG
>probe:Drosophila_2:1632250_at:279:575; Interrogation_Position=346; Antisense; GGCGGTAGCTTCTACATTCAGTCGA
>probe:Drosophila_2:1632250_at:303:213; Interrogation_Position=511; Antisense; AAGAGCCGATGATCCTTCGCAGCTG
>probe:Drosophila_2:1632250_at:20:121; Interrogation_Position=531; Antisense; AGCTGTATTCACATGGATTGCCTTT
>probe:Drosophila_2:1632250_at:203:237; Interrogation_Position=572; Antisense; AATCGTCTTCGAACTTTTTGTACAT
>probe:Drosophila_2:1632250_at:124:567; Interrogation_Position=72; Antisense; GGCACGGTACTTAGCGCAAATCATC
>probe:Drosophila_2:1632250_at:138:165; Interrogation_Position=89; Antisense; AAATCATCATTTTGGGTGCCCAGCT

Paste this into a BLAST search page for me
GCGGCACGCCTACAGGAAACGCTAATAAAGGCCAACGATCCCAACAGCGGAAGACAATGACCCTGGCGGAGGCCCGAGGCCCAGCAGATTCTCGATGTGATCGATGTGAGTGACCTTACCAACCGGATAGATACGCACTACCAGCACTTGACCAGCACTTGTTTCGTGTGAACGATGAACGACAAATCCACCGGCGGTAGGGCGGTAGCTTCTACATTCAGTCGAAAGAGCCGATGATCCTTCGCAGCTGAGCTGTATTCACATGGATTGCCTTTAATCGTCTTCGAACTTTTTGTACATGGCACGGTACTTAGCGCAAATCATCAAATCATCATTTTGGGTGCCCAGCT

Full Affymetrix probeset data:

Annotations for 1632250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720