Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632254_a_at:

>probe:Drosophila_2:1632254_a_at:105:181; Interrogation_Position=147; Antisense; AAACAGCCGAGAGGATCAGTCGCCA
>probe:Drosophila_2:1632254_a_at:158:549; Interrogation_Position=249; Antisense; GGAGGAATCCCTGAAATGCCCATGG
>probe:Drosophila_2:1632254_a_at:712:233; Interrogation_Position=263; Antisense; AATGCCCATGGACCTGCACATGATG
>probe:Drosophila_2:1632254_a_at:187:61; Interrogation_Position=281; Antisense; CATGATGCATGCTCCATGTGACATG
>probe:Drosophila_2:1632254_a_at:632:101; Interrogation_Position=322; Antisense; AGAGCTATATATTCGCCTTTCCCAA
>probe:Drosophila_2:1632254_a_at:502:315; Interrogation_Position=336; Antisense; GCCTTTCCCAACCATTGCATATGGG
>probe:Drosophila_2:1632254_a_at:5:681; Interrogation_Position=355; Antisense; TATGGGCGTTCAACAATCGGTACAT
>probe:Drosophila_2:1632254_a_at:30:73; Interrogation_Position=386; Antisense; AGGACATTTCCGCATCTACAAGACC
>probe:Drosophila_2:1632254_a_at:18:39; Interrogation_Position=399; Antisense; ATCTACAAGACCTACCAGTTGGAAG
>probe:Drosophila_2:1632254_a_at:289:543; Interrogation_Position=423; Antisense; GGATTTTTCTTTGGCCAGTATTACG
>probe:Drosophila_2:1632254_a_at:209:203; Interrogation_Position=456; Antisense; AAGCGTTACGAATTCGAGCCACATT
>probe:Drosophila_2:1632254_a_at:263:415; Interrogation_Position=471; Antisense; GAGCCACATTCCTACGATTACAATA
>probe:Drosophila_2:1632254_a_at:71:511; Interrogation_Position=516; Antisense; GTGCAGCGATCAAATTCTAACTATT
>probe:Drosophila_2:1632254_a_at:524:405; Interrogation_Position=543; Antisense; GACGGACTACCAAGACATTTCCTTT

Paste this into a BLAST search page for me
AAACAGCCGAGAGGATCAGTCGCCAGGAGGAATCCCTGAAATGCCCATGGAATGCCCATGGACCTGCACATGATGCATGATGCATGCTCCATGTGACATGAGAGCTATATATTCGCCTTTCCCAAGCCTTTCCCAACCATTGCATATGGGTATGGGCGTTCAACAATCGGTACATAGGACATTTCCGCATCTACAAGACCATCTACAAGACCTACCAGTTGGAAGGGATTTTTCTTTGGCCAGTATTACGAAGCGTTACGAATTCGAGCCACATTGAGCCACATTCCTACGATTACAATAGTGCAGCGATCAAATTCTAACTATTGACGGACTACCAAGACATTTCCTTT

Full Affymetrix probeset data:

Annotations for 1632254_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime