FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632256_at:

>probe:Drosophila_2:1632256_at:581:385; Interrogation_Position=5972; Antisense; GAACAACGGAATGGGCATCGATGAT
>probe:Drosophila_2:1632256_at:52:139; Interrogation_Position=6028; Antisense; ACGATGGTTCTCGAGTGCGTATCAA
>probe:Drosophila_2:1632256_at:674:529; Interrogation_Position=6073; Antisense; GGGATTACGCCTTGCAGCACCAGCA
>probe:Drosophila_2:1632256_at:532:111; Interrogation_Position=6088; Antisense; AGCACCAGCAGATGGGACAGGCAGC
>probe:Drosophila_2:1632256_at:177:401; Interrogation_Position=6103; Antisense; GACAGGCAGCATCGCAGTCGCAGAT
>probe:Drosophila_2:1632256_at:105:351; Interrogation_Position=6116; Antisense; GCAGTCGCAGATATACATGGTGGAT
>probe:Drosophila_2:1632256_at:599:63; Interrogation_Position=6132; Antisense; ATGGTGGATTCGTCCAACGAGCCCA
>probe:Drosophila_2:1632256_at:220:197; Interrogation_Position=6184; Antisense; AACTGGACTTCCAACAAGTGCAGGA
>probe:Drosophila_2:1632256_at:223:113; Interrogation_Position=6223; Antisense; AGCACCAAGTGATGCCACCAATGCA
>probe:Drosophila_2:1632256_at:23:449; Interrogation_Position=6233; Antisense; GATGCCACCAATGCAATCAGAGCAA
>probe:Drosophila_2:1632256_at:609:187; Interrogation_Position=6268; Antisense; AACAGACGCCGCAGGGAGACAATGA
>probe:Drosophila_2:1632256_at:107:423; Interrogation_Position=6283; Antisense; GAGACAATGATTATGCCTGGACTTT
>probe:Drosophila_2:1632256_at:69:25; Interrogation_Position=6361; Antisense; ATAGGATTGAGCTTCGCTGTGAAAC
>probe:Drosophila_2:1632256_at:231:185; Interrogation_Position=6453; Antisense; AAAATATTTCCTTTTCATGCCAATA

Paste this into a BLAST search page for me
GAACAACGGAATGGGCATCGATGATACGATGGTTCTCGAGTGCGTATCAAGGGATTACGCCTTGCAGCACCAGCAAGCACCAGCAGATGGGACAGGCAGCGACAGGCAGCATCGCAGTCGCAGATGCAGTCGCAGATATACATGGTGGATATGGTGGATTCGTCCAACGAGCCCAAACTGGACTTCCAACAAGTGCAGGAAGCACCAAGTGATGCCACCAATGCAGATGCCACCAATGCAATCAGAGCAAAACAGACGCCGCAGGGAGACAATGAGAGACAATGATTATGCCTGGACTTTATAGGATTGAGCTTCGCTGTGAAACAAAATATTTCCTTTTCATGCCAATA

Full Affymetrix probeset data:

Annotations for 1632256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720