Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632257_at:

>probe:Drosophila_2:1632257_at:195:201; Interrogation_Position=3951; Antisense; AACGCTGCTGACAAGCGCCAGGAGT
>probe:Drosophila_2:1632257_at:386:77; Interrogation_Position=3970; Antisense; AGGAGTGAGGCCAATGCCTCCCCAG
>probe:Drosophila_2:1632257_at:155:267; Interrogation_Position=4017; Antisense; CAGTGGGCAGCTGAGGATCAAGTTT
>probe:Drosophila_2:1632257_at:383:613; Interrogation_Position=4044; Antisense; TGAAGGAGACGAGACCCCACTGCTG
>probe:Drosophila_2:1632257_at:706:629; Interrogation_Position=4092; Antisense; TCCTCCACCGATTCCACAGATGGTG
>probe:Drosophila_2:1632257_at:403:61; Interrogation_Position=4111; Antisense; ATGGTGGCCGCCAGTCCGCAACGGA
>probe:Drosophila_2:1632257_at:566:195; Interrogation_Position=4130; Antisense; AACGGAGCGGCAGTGGCCAGAACAT
>probe:Drosophila_2:1632257_at:257:83; Interrogation_Position=4141; Antisense; AGTGGCCAGAACATTCCGGCGGACA
>probe:Drosophila_2:1632257_at:422:127; Interrogation_Position=4168; Antisense; AGCCACTACGGCTTCCTGGTGAAGA
>probe:Drosophila_2:1632257_at:654:375; Interrogation_Position=4188; Antisense; GAAGAGCTACAAGCAGCAGTGCCCA
>probe:Drosophila_2:1632257_at:559:579; Interrogation_Position=4248; Antisense; GGCCAAGATCAACTCATAGCTGTAT
>probe:Drosophila_2:1632257_at:451:145; Interrogation_Position=4285; Antisense; ACTCCCTCTTCACTGTAATCATATG
>probe:Drosophila_2:1632257_at:379:517; Interrogation_Position=4364; Antisense; GTGGTTAGTCAATAGTCGACCGAAT
>probe:Drosophila_2:1632257_at:36:307; Interrogation_Position=4445; Antisense; CCATCCCCTTACTCATAAGTAGCGA

Paste this into a BLAST search page for me
AACGCTGCTGACAAGCGCCAGGAGTAGGAGTGAGGCCAATGCCTCCCCAGCAGTGGGCAGCTGAGGATCAAGTTTTGAAGGAGACGAGACCCCACTGCTGTCCTCCACCGATTCCACAGATGGTGATGGTGGCCGCCAGTCCGCAACGGAAACGGAGCGGCAGTGGCCAGAACATAGTGGCCAGAACATTCCGGCGGACAAGCCACTACGGCTTCCTGGTGAAGAGAAGAGCTACAAGCAGCAGTGCCCAGGCCAAGATCAACTCATAGCTGTATACTCCCTCTTCACTGTAATCATATGGTGGTTAGTCAATAGTCGACCGAATCCATCCCCTTACTCATAAGTAGCGA

Full Affymetrix probeset data:

Annotations for 1632257_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime