FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632259_at:

>probe:Drosophila_2:1632259_at:334:677; Interrogation_Position=1008; Antisense; TAGTTCGCGTGCAGTTTTCGACGAT
>probe:Drosophila_2:1632259_at:551:461; Interrogation_Position=1074; Antisense; GATTATGACTCTGATTGCCTTCACC
>probe:Drosophila_2:1632259_at:581:191; Interrogation_Position=1117; Antisense; AACTTCATTGGACTGTACATTGCGA
>probe:Drosophila_2:1632259_at:72:669; Interrogation_Position=1132; Antisense; TACATTGCGATGTACTCGTCCAGCG
>probe:Drosophila_2:1632259_at:102:673; Interrogation_Position=1181; Antisense; TACGCGTTTACTTCATCTGGGTGTT
>probe:Drosophila_2:1632259_at:249:367; Interrogation_Position=1233; Antisense; GAATCTGGTCACGATCATGGGCTTC
>probe:Drosophila_2:1632259_at:391:343; Interrogation_Position=1253; Antisense; GCTTCCTCATCCTGCAAATGGGTAT
>probe:Drosophila_2:1632259_at:109:169; Interrogation_Position=1268; Antisense; AAATGGGTATCATCCTCTACCGACA
>probe:Drosophila_2:1632259_at:580:539; Interrogation_Position=1334; Antisense; GGTATCGTGCTCGTTACGTGGATTT
>probe:Drosophila_2:1632259_at:25:63; Interrogation_Position=1455; Antisense; ATGGGCTGCAAATCAACCCTGGGCT
>probe:Drosophila_2:1632259_at:545:201; Interrogation_Position=1469; Antisense; AACCCTGGGCTGATTCTTGAAGATT
>probe:Drosophila_2:1632259_at:68:21; Interrogation_Position=967; Antisense; ATTTGCATGAACTTCCTGCCGAGCA
>probe:Drosophila_2:1632259_at:108:631; Interrogation_Position=980; Antisense; TCCTGCCGAGCATTGATCCATTTAG
>probe:Drosophila_2:1632259_at:708:447; Interrogation_Position=994; Antisense; GATCCATTTAGCTGTAGTTCGCGTG

Paste this into a BLAST search page for me
TAGTTCGCGTGCAGTTTTCGACGATGATTATGACTCTGATTGCCTTCACCAACTTCATTGGACTGTACATTGCGATACATTGCGATGTACTCGTCCAGCGTACGCGTTTACTTCATCTGGGTGTTGAATCTGGTCACGATCATGGGCTTCGCTTCCTCATCCTGCAAATGGGTATAAATGGGTATCATCCTCTACCGACAGGTATCGTGCTCGTTACGTGGATTTATGGGCTGCAAATCAACCCTGGGCTAACCCTGGGCTGATTCTTGAAGATTATTTGCATGAACTTCCTGCCGAGCATCCTGCCGAGCATTGATCCATTTAGGATCCATTTAGCTGTAGTTCGCGTG

Full Affymetrix probeset data:

Annotations for 1632259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720