FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632261_at:

>probe:Drosophila_2:1632261_at:532:73; Interrogation_Position=1602; Antisense; AGGAAATGCATGAGGCCGACGAAGT
>probe:Drosophila_2:1632261_at:581:97; Interrogation_Position=1656; Antisense; AGATCGAGCTCATGCTCTTCCTGTA
>probe:Drosophila_2:1632261_at:73:619; Interrogation_Position=1668; Antisense; TGCTCTTCCTGTATCGCCGTTTAGA
>probe:Drosophila_2:1632261_at:248:417; Interrogation_Position=1691; Antisense; GAGCGAAGCATTCTCGCCGGAGCTT
>probe:Drosophila_2:1632261_at:705:315; Interrogation_Position=1706; Antisense; GCCGGAGCTTTACAATACGCCCAAG
>probe:Drosophila_2:1632261_at:614:241; Interrogation_Position=1719; Antisense; AATACGCCCAAGAGCATCGCAAGGT
>probe:Drosophila_2:1632261_at:314:419; Interrogation_Position=1730; Antisense; GAGCATCGCAAGGTCTAGGGATTTA
>probe:Drosophila_2:1632261_at:82:531; Interrogation_Position=1747; Antisense; GGGATTTAAGCAGACAACCCACAAA
>probe:Drosophila_2:1632261_at:723:433; Interrogation_Position=1776; Antisense; GAGTGGCCATCGAAAGCGAAATCAA
>probe:Drosophila_2:1632261_at:15:233; Interrogation_Position=1799; Antisense; AATAACTCAGTCTAGCATTAGCAAT
>probe:Drosophila_2:1632261_at:72:13; Interrogation_Position=1961; Antisense; ATTCTGCTAGATTTTAAACTCGTGT
>probe:Drosophila_2:1632261_at:159:179; Interrogation_Position=1976; Antisense; AAACTCGTGTTCGTCTAGTGTGCTA
>probe:Drosophila_2:1632261_at:17:517; Interrogation_Position=1993; Antisense; GTGTGCTACGCGCATTCTAGGATAT
>probe:Drosophila_2:1632261_at:26:499; Interrogation_Position=2096; Antisense; GTCTAACAGCGCAATGTAACCTTTT

Paste this into a BLAST search page for me
AGGAAATGCATGAGGCCGACGAAGTAGATCGAGCTCATGCTCTTCCTGTATGCTCTTCCTGTATCGCCGTTTAGAGAGCGAAGCATTCTCGCCGGAGCTTGCCGGAGCTTTACAATACGCCCAAGAATACGCCCAAGAGCATCGCAAGGTGAGCATCGCAAGGTCTAGGGATTTAGGGATTTAAGCAGACAACCCACAAAGAGTGGCCATCGAAAGCGAAATCAAAATAACTCAGTCTAGCATTAGCAATATTCTGCTAGATTTTAAACTCGTGTAAACTCGTGTTCGTCTAGTGTGCTAGTGTGCTACGCGCATTCTAGGATATGTCTAACAGCGCAATGTAACCTTTT

Full Affymetrix probeset data:

Annotations for 1632261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720