FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632262_at:

>probe:Drosophila_2:1632262_at:369:483; Interrogation_Position=1057; Antisense; GTATACACACGGGTTTCATTCACGT
>probe:Drosophila_2:1632262_at:546:129; Interrogation_Position=1114; Antisense; ACCTTAGCCATAGTTCTTTCTTGAA
>probe:Drosophila_2:1632262_at:592:269; Interrogation_Position=1141; Antisense; CATCGGAGCGGTTTTCAGCACGTAA
>probe:Drosophila_2:1632262_at:240:173; Interrogation_Position=1177; Antisense; AAAGCAGGCTCGGATCTCATGATGA
>probe:Drosophila_2:1632262_at:446:445; Interrogation_Position=683; Antisense; GATGAAGCTGATACATGGCCGCATT
>probe:Drosophila_2:1632262_at:313:153; Interrogation_Position=695; Antisense; ACATGGCCGCATTCTGGTGGGACAC
>probe:Drosophila_2:1632262_at:165:625; Interrogation_Position=724; Antisense; TGCGCAACGATCTTGCCGTACTGGG
>probe:Drosophila_2:1632262_at:128:271; Interrogation_Position=756; Antisense; CATCCGTTCCATGACATTCGTGATA
>probe:Drosophila_2:1632262_at:381:457; Interrogation_Position=777; Antisense; GATACGTCGCATTATAAGCCGCTGT
>probe:Drosophila_2:1632262_at:245:297; Interrogation_Position=796; Antisense; CGCTGTGCAAACTCATCTCTAATAC
>probe:Drosophila_2:1632262_at:562:169; Interrogation_Position=848; Antisense; AAAGGCCGTTCTGGGTCAGGAGATC
>probe:Drosophila_2:1632262_at:133:65; Interrogation_Position=915; Antisense; ATGGGTATCTACAATCGCGTTGCCG
>probe:Drosophila_2:1632262_at:310:45; Interrogation_Position=928; Antisense; ATCGCGTTGCCGTCGACTGGGAGAA
>probe:Drosophila_2:1632262_at:132:113; Interrogation_Position=979; Antisense; AGCAGCACTATTAGCAGCTCACTCG

Paste this into a BLAST search page for me
GTATACACACGGGTTTCATTCACGTACCTTAGCCATAGTTCTTTCTTGAACATCGGAGCGGTTTTCAGCACGTAAAAAGCAGGCTCGGATCTCATGATGAGATGAAGCTGATACATGGCCGCATTACATGGCCGCATTCTGGTGGGACACTGCGCAACGATCTTGCCGTACTGGGCATCCGTTCCATGACATTCGTGATAGATACGTCGCATTATAAGCCGCTGTCGCTGTGCAAACTCATCTCTAATACAAAGGCCGTTCTGGGTCAGGAGATCATGGGTATCTACAATCGCGTTGCCGATCGCGTTGCCGTCGACTGGGAGAAAGCAGCACTATTAGCAGCTCACTCG

Full Affymetrix probeset data:

Annotations for 1632262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720