FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632263_at:

>probe:Drosophila_2:1632263_at:13:417; Interrogation_Position=371; Antisense; GAGCCGGAATTGCACAAGCTATCCA
>probe:Drosophila_2:1632263_at:23:709; Interrogation_Position=401; Antisense; TTAACTGGCCAGGTGGGACTGCTTT
>probe:Drosophila_2:1632263_at:724:591; Interrogation_Position=414; Antisense; TGGGACTGCTTTTCACGGACAAATC
>probe:Drosophila_2:1632263_at:87:193; Interrogation_Position=467; Antisense; AACTACTGGGCCGTGGAATACGCAC
>probe:Drosophila_2:1632263_at:318:365; Interrogation_Position=482; Antisense; GAATACGCACGCAGTGGCTTTGTGG
>probe:Drosophila_2:1632263_at:82:521; Interrogation_Position=502; Antisense; TGTGGCCACGGAAACGGTTACCCTG
>probe:Drosophila_2:1632263_at:142:259; Interrogation_Position=554; Antisense; CACTCTATGGAACCGCATCTGCGTT
>probe:Drosophila_2:1632263_at:359:521; Interrogation_Position=583; Antisense; GGGCCTGCCCACCAAATTGGAGAAG
>probe:Drosophila_2:1632263_at:100:365; Interrogation_Position=609; Antisense; GAATCGTTACGCTGTACAGTGACTA
>probe:Drosophila_2:1632263_at:82:471; Interrogation_Position=656; Antisense; GTTCTAACACCCGAACAGGCGAGAA
>probe:Drosophila_2:1632263_at:230:325; Interrogation_Position=674; Antisense; GCGAGAATCCTCAAGCTGGTGGGCA
>probe:Drosophila_2:1632263_at:651:517; Interrogation_Position=692; Antisense; GTGGGCAAGCCCATGGCCAAATTTC
>probe:Drosophila_2:1632263_at:93:19; Interrogation_Position=712; Antisense; ATTTCGGCTGACCATGAAGTGCTCG
>probe:Drosophila_2:1632263_at:269:227; Interrogation_Position=750; Antisense; AAGGCTTCCAGCTGCATGTCGAGGA

Paste this into a BLAST search page for me
GAGCCGGAATTGCACAAGCTATCCATTAACTGGCCAGGTGGGACTGCTTTTGGGACTGCTTTTCACGGACAAATCAACTACTGGGCCGTGGAATACGCACGAATACGCACGCAGTGGCTTTGTGGTGTGGCCACGGAAACGGTTACCCTGCACTCTATGGAACCGCATCTGCGTTGGGCCTGCCCACCAAATTGGAGAAGGAATCGTTACGCTGTACAGTGACTAGTTCTAACACCCGAACAGGCGAGAAGCGAGAATCCTCAAGCTGGTGGGCAGTGGGCAAGCCCATGGCCAAATTTCATTTCGGCTGACCATGAAGTGCTCGAAGGCTTCCAGCTGCATGTCGAGGA

Full Affymetrix probeset data:

Annotations for 1632263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720