FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632264_at:

>probe:Drosophila_2:1632264_at:415:77; Interrogation_Position=1005; Antisense; AGGATACTGCATGCATTCCCTGCTC
>probe:Drosophila_2:1632264_at:150:339; Interrogation_Position=1026; Antisense; GCTCTGTCCAGGCATCAGCAAAATT
>probe:Drosophila_2:1632264_at:163:679; Interrogation_Position=1065; Antisense; TAGTTTATACACACCATCTCTTGTT
>probe:Drosophila_2:1632264_at:542:649; Interrogation_Position=1126; Antisense; TCAAACTGATTGTCGCTGAGGCGTC
>probe:Drosophila_2:1632264_at:425:475; Interrogation_Position=1157; Antisense; GTTACTTTCCAGCTCATTGTTATTT
>probe:Drosophila_2:1632264_at:547:727; Interrogation_Position=1207; Antisense; TTGGAAAGTATCATCGCCGTCGACG
>probe:Drosophila_2:1632264_at:88:301; Interrogation_Position=1221; Antisense; CGCCGTCGACGTCCAGATAGATGAT
>probe:Drosophila_2:1632264_at:402:603; Interrogation_Position=1359; Antisense; TGTTCACTGTCTGTCCTCGAAATAA
>probe:Drosophila_2:1632264_at:525:249; Interrogation_Position=855; Antisense; CAATATTCCAGTGGTCTGACCTCGT
>probe:Drosophila_2:1632264_at:448:413; Interrogation_Position=872; Antisense; GACCTCGTCGTGTTTGTTGCTGCGA
>probe:Drosophila_2:1632264_at:511:469; Interrogation_Position=887; Antisense; GTTGCTGCGACGCTGGAAGTCCATA
>probe:Drosophila_2:1632264_at:660:419; Interrogation_Position=914; Antisense; GAGCTTGTGAATCTCTCTGGGAGCC
>probe:Drosophila_2:1632264_at:701:285; Interrogation_Position=930; Antisense; CTGGGAGCCGAGAGGTTCAACCGAC
>probe:Drosophila_2:1632264_at:160:391; Interrogation_Position=978; Antisense; GAAACATGCACAACAGGCCCAAGGA

Paste this into a BLAST search page for me
AGGATACTGCATGCATTCCCTGCTCGCTCTGTCCAGGCATCAGCAAAATTTAGTTTATACACACCATCTCTTGTTTCAAACTGATTGTCGCTGAGGCGTCGTTACTTTCCAGCTCATTGTTATTTTTGGAAAGTATCATCGCCGTCGACGCGCCGTCGACGTCCAGATAGATGATTGTTCACTGTCTGTCCTCGAAATAACAATATTCCAGTGGTCTGACCTCGTGACCTCGTCGTGTTTGTTGCTGCGAGTTGCTGCGACGCTGGAAGTCCATAGAGCTTGTGAATCTCTCTGGGAGCCCTGGGAGCCGAGAGGTTCAACCGACGAAACATGCACAACAGGCCCAAGGA

Full Affymetrix probeset data:

Annotations for 1632264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720