Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632266_at:

>probe:Drosophila_2:1632266_at:298:421; Interrogation_Position=1024; Antisense; GAGCAGAATCTGTACTACGCCCAGA
>probe:Drosophila_2:1632266_at:101:97; Interrogation_Position=1046; Antisense; AGATACGCGGTCTGCTTGTGGACGC
>probe:Drosophila_2:1632266_at:242:411; Interrogation_Position=1066; Antisense; GACGCCTATTGCGAGAAGTCCGCCT
>probe:Drosophila_2:1632266_at:484:603; Interrogation_Position=1103; Antisense; TGATTCCCACGCAGGACAGTCCGGA
>probe:Drosophila_2:1632266_at:62:413; Interrogation_Position=1166; Antisense; GACCCGATGAGGAGCTGTCCCGGAA
>probe:Drosophila_2:1632266_at:386:563; Interrogation_Position=1187; Antisense; GGAAGCTCTGCTACCTAGAGTTCGT
>probe:Drosophila_2:1632266_at:661:675; Interrogation_Position=1202; Antisense; TAGAGTTCGTGATGCATGCTCCCAG
>probe:Drosophila_2:1632266_at:221:407; Interrogation_Position=1267; Antisense; GACGTGGATGAGTACACTGCCCAGA
>probe:Drosophila_2:1632266_at:282:97; Interrogation_Position=1291; Antisense; AGATCGGGCGGCTACATCTGGACGC
>probe:Drosophila_2:1632266_at:685:173; Interrogation_Position=1354; Antisense; AAAGCGGGCGGTGCCTCCTAGCAGA
>probe:Drosophila_2:1632266_at:289:69; Interrogation_Position=1399; Antisense; ATGGCCGGAGCCCTGAATTTGAAAA
>probe:Drosophila_2:1632266_at:407:703; Interrogation_Position=1431; Antisense; TTATTGCAACTTTTACTCTTCGTAA
>probe:Drosophila_2:1632266_at:193:491; Interrogation_Position=1452; Antisense; GTAAACGGGCTACTTGCCGAACAGA
>probe:Drosophila_2:1632266_at:714:203; Interrogation_Position=963; Antisense; AAGCCTTTTCCACAAGGGCAGCTAT

Paste this into a BLAST search page for me
GAGCAGAATCTGTACTACGCCCAGAAGATACGCGGTCTGCTTGTGGACGCGACGCCTATTGCGAGAAGTCCGCCTTGATTCCCACGCAGGACAGTCCGGAGACCCGATGAGGAGCTGTCCCGGAAGGAAGCTCTGCTACCTAGAGTTCGTTAGAGTTCGTGATGCATGCTCCCAGGACGTGGATGAGTACACTGCCCAGAAGATCGGGCGGCTACATCTGGACGCAAAGCGGGCGGTGCCTCCTAGCAGAATGGCCGGAGCCCTGAATTTGAAAATTATTGCAACTTTTACTCTTCGTAAGTAAACGGGCTACTTGCCGAACAGAAAGCCTTTTCCACAAGGGCAGCTAT

Full Affymetrix probeset data:

Annotations for 1632266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime