Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632267_a_at:

>probe:Drosophila_2:1632267_a_at:705:467; Interrogation_Position=263; Antisense; GTTGAACGAACTTTTGACTGCCACA
>probe:Drosophila_2:1632267_a_at:511:405; Interrogation_Position=278; Antisense; GACTGCCACAGTGAAGCGCTTGGAA
>probe:Drosophila_2:1632267_a_at:338:379; Interrogation_Position=290; Antisense; GAAGCGCTTGGAAACTCAGCTGAAA
>probe:Drosophila_2:1632267_a_at:300:393; Interrogation_Position=332; Antisense; GAAAGAGCCCGAGGTCGAAGCGAAA
>probe:Drosophila_2:1632267_a_at:38:691; Interrogation_Position=494; Antisense; TATTGCCAAGTCGAACATCATTCTG
>probe:Drosophila_2:1632267_a_at:569:273; Interrogation_Position=512; Antisense; CATTCTGGATGTTAAGCCGTGGGAC
>probe:Drosophila_2:1632267_a_at:608:125; Interrogation_Position=526; Antisense; AGCCGTGGGACGATGAGACCGATCT
>probe:Drosophila_2:1632267_a_at:459:407; Interrogation_Position=563; Antisense; GACGGAAATCCGCAAAATCACCCAG
>probe:Drosophila_2:1632267_a_at:167:165; Interrogation_Position=577; Antisense; AAATCACCCAGGACGGTCTACTGTG
>probe:Drosophila_2:1632267_a_at:552:527; Interrogation_Position=602; Antisense; GGGAGCTTCCAAATTCGTGCCAGTT
>probe:Drosophila_2:1632267_a_at:506:469; Interrogation_Position=624; Antisense; GTTGCCTTTGGCATTCAGAAACTGA
>probe:Drosophila_2:1632267_a_at:495:223; Interrogation_Position=675; Antisense; AAGGTTTCCATCGATTGGCTGACTG
>probe:Drosophila_2:1632267_a_at:247:255; Interrogation_Position=729; Antisense; CAAAGTGTTGACATCGCTGCGTTCA
>probe:Drosophila_2:1632267_a_at:131:137; Interrogation_Position=790; Antisense; ACGATCGGATTTGCCGCATTACAAA

Paste this into a BLAST search page for me
GTTGAACGAACTTTTGACTGCCACAGACTGCCACAGTGAAGCGCTTGGAAGAAGCGCTTGGAAACTCAGCTGAAAGAAAGAGCCCGAGGTCGAAGCGAAATATTGCCAAGTCGAACATCATTCTGCATTCTGGATGTTAAGCCGTGGGACAGCCGTGGGACGATGAGACCGATCTGACGGAAATCCGCAAAATCACCCAGAAATCACCCAGGACGGTCTACTGTGGGGAGCTTCCAAATTCGTGCCAGTTGTTGCCTTTGGCATTCAGAAACTGAAAGGTTTCCATCGATTGGCTGACTGCAAAGTGTTGACATCGCTGCGTTCAACGATCGGATTTGCCGCATTACAAA

Full Affymetrix probeset data:

Annotations for 1632267_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime