FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632269_at:

>probe:Drosophila_2:1632269_at:273:723; Interrogation_Position=366; Antisense; TTGCCCAGGCTGAGTCGCTGAGGTA
>probe:Drosophila_2:1632269_at:153:607; Interrogation_Position=384; Antisense; TGAGGTACAAGCTCACCGGAGGACT
>probe:Drosophila_2:1632269_at:497:507; Interrogation_Position=420; Antisense; GTGCTTGCTATGGTGTGCTCCGCTA
>probe:Drosophila_2:1632269_at:396:433; Interrogation_Position=473; Antisense; GAGGTCGTCGTGTCCGGCAAACTGC
>probe:Drosophila_2:1632269_at:636:177; Interrogation_Position=491; Antisense; AAACTGCGTGGTCAGCGTGCCAAGT
>probe:Drosophila_2:1632269_at:406:163; Interrogation_Position=521; Antisense; AAATTCGTCGATGGCCTGATGATCC
>probe:Drosophila_2:1632269_at:509:427; Interrogation_Position=552; Antisense; GAGATCCGTGCAACGACTATGTCGA
>probe:Drosophila_2:1632269_at:399:633; Interrogation_Position=600; Antisense; TCCGCCAGGGAGTGCTTGGTATCAA
>probe:Drosophila_2:1632269_at:721:77; Interrogation_Position=624; Antisense; AGGTCAAGGTCATGTTGCCCTACGA
>probe:Drosophila_2:1632269_at:205:251; Interrogation_Position=688; Antisense; CAATGTGTCCGTTGTGGAGCCCAAG
>probe:Drosophila_2:1632269_at:171:423; Interrogation_Position=716; Antisense; GAGAAGATCTACGAGACGCCCGAGA
>probe:Drosophila_2:1632269_at:21:425; Interrogation_Position=728; Antisense; GAGACGCCCGAGACCGAGTACAAGA
>probe:Drosophila_2:1632269_at:524:409; Interrogation_Position=776; Antisense; GACGATCTGTCCGAGGCGAAAGTTT
>probe:Drosophila_2:1632269_at:86:405; Interrogation_Position=834; Antisense; GACTAGCTGAAAGAGTTGCCCTCAA

Paste this into a BLAST search page for me
TTGCCCAGGCTGAGTCGCTGAGGTATGAGGTACAAGCTCACCGGAGGACTGTGCTTGCTATGGTGTGCTCCGCTAGAGGTCGTCGTGTCCGGCAAACTGCAAACTGCGTGGTCAGCGTGCCAAGTAAATTCGTCGATGGCCTGATGATCCGAGATCCGTGCAACGACTATGTCGATCCGCCAGGGAGTGCTTGGTATCAAAGGTCAAGGTCATGTTGCCCTACGACAATGTGTCCGTTGTGGAGCCCAAGGAGAAGATCTACGAGACGCCCGAGAGAGACGCCCGAGACCGAGTACAAGAGACGATCTGTCCGAGGCGAAAGTTTGACTAGCTGAAAGAGTTGCCCTCAA

Full Affymetrix probeset data:

Annotations for 1632269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720