FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632273_at:

>probe:Drosophila_2:1632273_at:115:267; Interrogation_Position=4448; Antisense; CAGGAGTGAGAAACGGTGGCCCAAA
>probe:Drosophila_2:1632273_at:5:561; Interrogation_Position=4485; Antisense; GGAAATCGCATTTAACCAAATCTGG
>probe:Drosophila_2:1632273_at:494:235; Interrogation_Position=4503; Antisense; AATCTGGTGCTTATAATGGCTCAAG
>probe:Drosophila_2:1632273_at:436:79; Interrogation_Position=4526; Antisense; AGGTTACAACTCTTGGGCTCCCAAT
>probe:Drosophila_2:1632273_at:546:165; Interrogation_Position=4587; Antisense; AAATGATTTTCTTGTGCACATACAC
>probe:Drosophila_2:1632273_at:35:241; Interrogation_Position=4624; Antisense; CAATGTTTCATTTCCTTAGTTTAGT
>probe:Drosophila_2:1632273_at:103:109; Interrogation_Position=4671; Antisense; AGAATGTGTACTGCCTTATACGTAT
>probe:Drosophila_2:1632273_at:147:33; Interrogation_Position=4710; Antisense; ATCTCCACCAGGGACTACGTTGTAA
>probe:Drosophila_2:1632273_at:529:493; Interrogation_Position=4731; Antisense; GTAATATTTGTCCACCAACCTATTG
>probe:Drosophila_2:1632273_at:326:203; Interrogation_Position=4747; Antisense; AACCTATTGTAGACCGCCAGTGAAT
>probe:Drosophila_2:1632273_at:533:203; Interrogation_Position=4797; Antisense; AAGCTACTTACATTCTGGTACCGGA
>probe:Drosophila_2:1632273_at:645:107; Interrogation_Position=4824; Antisense; AGAACTGAAACACCGAGGTCCTCAA
>probe:Drosophila_2:1632273_at:305:503; Interrogation_Position=4841; Antisense; GTCCTCAAAGGATCAGTGGGTTAAT
>probe:Drosophila_2:1632273_at:500:517; Interrogation_Position=4856; Antisense; GTGGGTTAATCTACTCACTAGTTAG

Paste this into a BLAST search page for me
CAGGAGTGAGAAACGGTGGCCCAAAGGAAATCGCATTTAACCAAATCTGGAATCTGGTGCTTATAATGGCTCAAGAGGTTACAACTCTTGGGCTCCCAATAAATGATTTTCTTGTGCACATACACCAATGTTTCATTTCCTTAGTTTAGTAGAATGTGTACTGCCTTATACGTATATCTCCACCAGGGACTACGTTGTAAGTAATATTTGTCCACCAACCTATTGAACCTATTGTAGACCGCCAGTGAATAAGCTACTTACATTCTGGTACCGGAAGAACTGAAACACCGAGGTCCTCAAGTCCTCAAAGGATCAGTGGGTTAATGTGGGTTAATCTACTCACTAGTTAG

Full Affymetrix probeset data:

Annotations for 1632273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720