FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632274_at:

>probe:Drosophila_2:1632274_at:126:231; Interrogation_Position=1039; Antisense; AATGTGCGATCTAAAGCACCTGCTG
>probe:Drosophila_2:1632274_at:524:283; Interrogation_Position=1061; Antisense; CTGCGCGACTTTGGAGCCGAATTTG
>probe:Drosophila_2:1632274_at:730:317; Interrogation_Position=1076; Antisense; GCCGAATTTGGATCGCTGAGCGACA
>probe:Drosophila_2:1632274_at:531:513; Interrogation_Position=1121; Antisense; GTGATGCATGCAGAACTGGCCCGAA
>probe:Drosophila_2:1632274_at:328:141; Interrogation_Position=1135; Antisense; ACTGGCCCGAAGCTACTAGATTTTA
>probe:Drosophila_2:1632274_at:196:707; Interrogation_Position=1157; Antisense; TTAGACCTAAGATCGTACTGTACAT
>probe:Drosophila_2:1632274_at:324:699; Interrogation_Position=1184; Antisense; TTTACTACTGGATCATTACCACTGA
>probe:Drosophila_2:1632274_at:539:369; Interrogation_Position=1213; Antisense; GAATGACACATGCAACTATCGCTTA
>probe:Drosophila_2:1632274_at:624:599; Interrogation_Position=1240; Antisense; TGTAACCAAGTCTACCAACTAACCT
>probe:Drosophila_2:1632274_at:622:165; Interrogation_Position=1255; Antisense; CAACTAACCTTTGAACGTGCCTACA
>probe:Drosophila_2:1632274_at:220:321; Interrogation_Position=878; Antisense; GCCCACATCAAGCTGATCGAGTACT
>probe:Drosophila_2:1632274_at:266:431; Interrogation_Position=896; Antisense; GAGTACTACTACAACCTGGCGCAGT
>probe:Drosophila_2:1632274_at:380:345; Interrogation_Position=974; Antisense; GCATTTGTGCCCGAACAGCAGCAGT
>probe:Drosophila_2:1632274_at:367:101; Interrogation_Position=993; Antisense; AGCAGTATGCGCTGGCGGAGATTAC

Paste this into a BLAST search page for me
AATGTGCGATCTAAAGCACCTGCTGCTGCGCGACTTTGGAGCCGAATTTGGCCGAATTTGGATCGCTGAGCGACAGTGATGCATGCAGAACTGGCCCGAAACTGGCCCGAAGCTACTAGATTTTATTAGACCTAAGATCGTACTGTACATTTTACTACTGGATCATTACCACTGAGAATGACACATGCAACTATCGCTTATGTAACCAAGTCTACCAACTAACCTCAACTAACCTTTGAACGTGCCTACAGCCCACATCAAGCTGATCGAGTACTGAGTACTACTACAACCTGGCGCAGTGCATTTGTGCCCGAACAGCAGCAGTAGCAGTATGCGCTGGCGGAGATTAC

Full Affymetrix probeset data:

Annotations for 1632274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720