Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632279_at:

>probe:Drosophila_2:1632279_at:427:183; Interrogation_Position=1221; Antisense; AAAAGCGAGATGTTTCTAGACGAAA
>probe:Drosophila_2:1632279_at:58:553; Interrogation_Position=1247; Antisense; GGAGAACTGTAAACTCTAACTGTAT
>probe:Drosophila_2:1632279_at:424:397; Interrogation_Position=1387; Antisense; GACAAGTACGAGAATAGCCGCATAA
>probe:Drosophila_2:1632279_at:608:419; Interrogation_Position=1413; Antisense; GAGCATAAAGCATAGATGTCGCATA
>probe:Drosophila_2:1632279_at:160:273; Interrogation_Position=1423; Antisense; CATAGATGTCGCATAGATGTTGATC
>probe:Drosophila_2:1632279_at:554:97; Interrogation_Position=1437; Antisense; AGATGTTGATCGAAGGTCCTGCGGA
>probe:Drosophila_2:1632279_at:419:43; Interrogation_Position=1445; Antisense; ATCGAAGGTCCTGCGGAAGGGATCA
>probe:Drosophila_2:1632279_at:525:491; Interrogation_Position=1483; Antisense; GTAAAGTAAACGTTCCATTGCAATT
>probe:Drosophila_2:1632279_at:109:471; Interrogation_Position=1494; Antisense; GTTCCATTGCAATTACACTTACATT
>probe:Drosophila_2:1632279_at:575:725; Interrogation_Position=1541; Antisense; TTGTTGGATATCGAAGCGACGGCGC
>probe:Drosophila_2:1632279_at:465:407; Interrogation_Position=1558; Antisense; GACGGCGCGGGCGAGTAACAACTTT
>probe:Drosophila_2:1632279_at:155:663; Interrogation_Position=1584; Antisense; TAAACTTTTGCTAGATCCAGGAACT
>probe:Drosophila_2:1632279_at:478:219; Interrogation_Position=1641; Antisense; AAGTCCTTCGTATACTATGTACTGA
>probe:Drosophila_2:1632279_at:582:157; Interrogation_Position=1669; Antisense; AAAGGCATCAAACTGAGCAACTTTG

Paste this into a BLAST search page for me
AAAAGCGAGATGTTTCTAGACGAAAGGAGAACTGTAAACTCTAACTGTATGACAAGTACGAGAATAGCCGCATAAGAGCATAAAGCATAGATGTCGCATACATAGATGTCGCATAGATGTTGATCAGATGTTGATCGAAGGTCCTGCGGAATCGAAGGTCCTGCGGAAGGGATCAGTAAAGTAAACGTTCCATTGCAATTGTTCCATTGCAATTACACTTACATTTTGTTGGATATCGAAGCGACGGCGCGACGGCGCGGGCGAGTAACAACTTTTAAACTTTTGCTAGATCCAGGAACTAAGTCCTTCGTATACTATGTACTGAAAAGGCATCAAACTGAGCAACTTTG

Full Affymetrix probeset data:

Annotations for 1632279_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime