FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632280_at:

>probe:Drosophila_2:1632280_at:640:153; Interrogation_Position=600; Antisense; ACAGACTACTGCCAGAGTTTGCCCA
>probe:Drosophila_2:1632280_at:636:479; Interrogation_Position=616; Antisense; GTTTGCCCACGATCAGGAATCCGGA
>probe:Drosophila_2:1632280_at:454:205; Interrogation_Position=666; Antisense; AAGCTCTCTGACCTGAAGTTCGATG
>probe:Drosophila_2:1632280_at:189:447; Interrogation_Position=687; Antisense; GATGCGCACGCCAGGGATAAGTTCC
>probe:Drosophila_2:1632280_at:444:651; Interrogation_Position=763; Antisense; TCACGGATCGCTGTCCGCAGAAGAA
>probe:Drosophila_2:1632280_at:667:105; Interrogation_Position=790; Antisense; AGAACTACGACTACGCCCTGTATCT
>probe:Drosophila_2:1632280_at:465:343; Interrogation_Position=822; Antisense; GCTTGCTATCACGAATCCTTTGTCA
>probe:Drosophila_2:1632280_at:194:235; Interrogation_Position=835; Antisense; AATCCTTTGTCACCGAGCCGTGGGA
>probe:Drosophila_2:1632280_at:129:237; Interrogation_Position=868; Antisense; AATCGGAGGCCGACATGGAGGTCTA
>probe:Drosophila_2:1632280_at:537:587; Interrogation_Position=883; Antisense; TGGAGGTCTATCTGTTCGAGCGTAA
>probe:Drosophila_2:1632280_at:252:417; Interrogation_Position=900; Antisense; GAGCGTAACCAGTCGAAGGTCTCCG
>probe:Drosophila_2:1632280_at:60:435; Interrogation_Position=927; Antisense; GAGGGAATCCTCAACTGGAACGCCA
>probe:Drosophila_2:1632280_at:528:381; Interrogation_Position=944; Antisense; GAACGCCAAGAAGGGTGCTCCAAAA
>probe:Drosophila_2:1632280_at:321:221; Interrogation_Position=967; Antisense; AAGTGGTTCCCAGCAAGTCATTCGC

Paste this into a BLAST search page for me
ACAGACTACTGCCAGAGTTTGCCCAGTTTGCCCACGATCAGGAATCCGGAAAGCTCTCTGACCTGAAGTTCGATGGATGCGCACGCCAGGGATAAGTTCCTCACGGATCGCTGTCCGCAGAAGAAAGAACTACGACTACGCCCTGTATCTGCTTGCTATCACGAATCCTTTGTCAAATCCTTTGTCACCGAGCCGTGGGAAATCGGAGGCCGACATGGAGGTCTATGGAGGTCTATCTGTTCGAGCGTAAGAGCGTAACCAGTCGAAGGTCTCCGGAGGGAATCCTCAACTGGAACGCCAGAACGCCAAGAAGGGTGCTCCAAAAAAGTGGTTCCCAGCAAGTCATTCGC

Full Affymetrix probeset data:

Annotations for 1632280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720