FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632281_at:

>probe:Drosophila_2:1632281_at:537:601; Interrogation_Position=3821; Antisense; TGCTTCCGCCGATGTCGTAGCCGAA
>probe:Drosophila_2:1632281_at:2:63; Interrogation_Position=3832; Antisense; ATGTCGTAGCCGAAGCTGATCCTTA
>probe:Drosophila_2:1632281_at:23:379; Interrogation_Position=3843; Antisense; GAAGCTGATCCTTAGGCGACAGACA
>probe:Drosophila_2:1632281_at:323:629; Interrogation_Position=3851; Antisense; TCCTTAGGCGACAGACAGATCAAAT
>probe:Drosophila_2:1632281_at:42:17; Interrogation_Position=3946; Antisense; CTTTAGTGTAACTCCATACATGCGA
>probe:Drosophila_2:1632281_at:214:665; Interrogation_Position=3962; Antisense; TACATGCGAACATTTTACCGTTTTT
>probe:Drosophila_2:1632281_at:427:5; Interrogation_Position=3989; Antisense; ATTGAGATTACGTAGCATTTTTGAC
>probe:Drosophila_2:1632281_at:251:555; Interrogation_Position=4035; Antisense; GGACGCTTTTAAAACCAGAGATTCA
>probe:Drosophila_2:1632281_at:253:295; Interrogation_Position=4068; Antisense; CGAGTGATTTAAATTGTCGTACAAT
>probe:Drosophila_2:1632281_at:6:501; Interrogation_Position=4083; Antisense; GTCGTACAATAGGAACCACAACTAC
>probe:Drosophila_2:1632281_at:488:587; Interrogation_Position=4119; Antisense; TGGAGCAACAGATACACACAGTTAT
>probe:Drosophila_2:1632281_at:212:551; Interrogation_Position=4206; Antisense; GGAGTAGAAGCCCAATCATAAACAA
>probe:Drosophila_2:1632281_at:180:259; Interrogation_Position=4298; Antisense; CACTCAAATTGTTTCTAATGCGCAG
>probe:Drosophila_2:1632281_at:180:297; Interrogation_Position=4318; Antisense; CGCAGATTCTAGGTACACGCATATT

Paste this into a BLAST search page for me
TGCTTCCGCCGATGTCGTAGCCGAAATGTCGTAGCCGAAGCTGATCCTTAGAAGCTGATCCTTAGGCGACAGACATCCTTAGGCGACAGACAGATCAAATCTTTAGTGTAACTCCATACATGCGATACATGCGAACATTTTACCGTTTTTATTGAGATTACGTAGCATTTTTGACGGACGCTTTTAAAACCAGAGATTCACGAGTGATTTAAATTGTCGTACAATGTCGTACAATAGGAACCACAACTACTGGAGCAACAGATACACACAGTTATGGAGTAGAAGCCCAATCATAAACAACACTCAAATTGTTTCTAATGCGCAGCGCAGATTCTAGGTACACGCATATT

Full Affymetrix probeset data:

Annotations for 1632281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720