Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632282_s_at:

>probe:Drosophila_2:1632282_s_at:52:169; Interrogation_Position=144; Antisense; AAATGTGGAATTAGTGCCCCTCTCA
>probe:Drosophila_2:1632282_s_at:652:555; Interrogation_Position=195; Antisense; GGACTTGGAAGTGGTGCCCTTACCA
>probe:Drosophila_2:1632282_s_at:252:213; Interrogation_Position=221; Antisense; AAGAGCCGAGCATTGACCTATCTGG
>probe:Drosophila_2:1632282_s_at:706:129; Interrogation_Position=236; Antisense; ACCTATCTGGTGCTGGCGATGGACA
>probe:Drosophila_2:1632282_s_at:100:407; Interrogation_Position=297; Antisense; GACTGTGATTATCTTTCTGCCCAGA
>probe:Drosophila_2:1632282_s_at:446:365; Interrogation_Position=320; Antisense; GAATAATGCCATTACCCTGGTCCAG
>probe:Drosophila_2:1632282_s_at:648:173; Interrogation_Position=348; Antisense; AAAGCGTCTGAAGCCGGTGATCATT
>probe:Drosophila_2:1632282_s_at:18:333; Interrogation_Position=373; Antisense; GCGGCCTCAAATATTCTCTTCAGAA
>probe:Drosophila_2:1632282_s_at:201:455; Interrogation_Position=399; Antisense; GATACTGTCCCATTTTGGAATCGAT
>probe:Drosophila_2:1632282_s_at:102:697; Interrogation_Position=423; Antisense; TTTAAATCAAGTCTTTGCCCTCGGC
>probe:Drosophila_2:1632282_s_at:34:695; Interrogation_Position=436; Antisense; TTTGCCCTCGGCTTGTCATACAATA
>probe:Drosophila_2:1632282_s_at:281:3; Interrogation_Position=55; Antisense; ATTGGCATACCGACTGAACTTCGCG
>probe:Drosophila_2:1632282_s_at:650:291; Interrogation_Position=78; Antisense; CGTGCACTGGGCCTACATAGTTGAT
>probe:Drosophila_2:1632282_s_at:552:151; Interrogation_Position=92; Antisense; ACATAGTTGATTTTCTACGCCCAGA

Paste this into a BLAST search page for me
AAATGTGGAATTAGTGCCCCTCTCAGGACTTGGAAGTGGTGCCCTTACCAAAGAGCCGAGCATTGACCTATCTGGACCTATCTGGTGCTGGCGATGGACAGACTGTGATTATCTTTCTGCCCAGAGAATAATGCCATTACCCTGGTCCAGAAAGCGTCTGAAGCCGGTGATCATTGCGGCCTCAAATATTCTCTTCAGAAGATACTGTCCCATTTTGGAATCGATTTTAAATCAAGTCTTTGCCCTCGGCTTTGCCCTCGGCTTGTCATACAATAATTGGCATACCGACTGAACTTCGCGCGTGCACTGGGCCTACATAGTTGATACATAGTTGATTTTCTACGCCCAGA

Full Affymetrix probeset data:

Annotations for 1632282_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime