FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632283_at:

>probe:Drosophila_2:1632283_at:183:299; Interrogation_Position=2061; Antisense; CGCTGTGGAACATGCTATCTCTGAT
>probe:Drosophila_2:1632283_at:221:477; Interrogation_Position=2109; Antisense; GTTATTATCGCTATATGCGCCGCCT
>probe:Drosophila_2:1632283_at:146:537; Interrogation_Position=2149; Antisense; GGTCGATACCAAGCCGATGCGAATA
>probe:Drosophila_2:1632283_at:229:447; Interrogation_Position=2164; Antisense; GATGCGAATATTCCAGGGCCATTAT
>probe:Drosophila_2:1632283_at:406:619; Interrogation_Position=2215; Antisense; TGCTCTAAACATCTACATGCCCATT
>probe:Drosophila_2:1632283_at:195:27; Interrogation_Position=2276; Antisense; ATAGCCGTTGCCTTTAACCAGCTGT
>probe:Drosophila_2:1632283_at:450:107; Interrogation_Position=2307; Antisense; AGAAGAAGGTGCTCCGCAAGTCGGC
>probe:Drosophila_2:1632283_at:248:691; Interrogation_Position=2354; Antisense; TTTGGCCAGCGCTACAAGGAGTTAC
>probe:Drosophila_2:1632283_at:80:225; Interrogation_Position=2369; Antisense; AAGGAGTTACGATCTGCCGGCCATG
>probe:Drosophila_2:1632283_at:654:57; Interrogation_Position=2391; Antisense; ATGAGTTAGCAGATTGCGCCGCACA
>probe:Drosophila_2:1632283_at:88:153; Interrogation_Position=2433; Antisense; ACATCGGACGTATCTATCACCAAGC
>probe:Drosophila_2:1632283_at:400:509; Interrogation_Position=2510; Antisense; GTGCATCCACTTATCGCAGAGCATG
>probe:Drosophila_2:1632283_at:275:55; Interrogation_Position=2532; Antisense; ATGAATCTACGCTTGGTCTGCAGCA
>probe:Drosophila_2:1632283_at:243:55; Interrogation_Position=2556; Antisense; ATGAAGTGGCATTCAACCTGCACCT

Paste this into a BLAST search page for me
CGCTGTGGAACATGCTATCTCTGATGTTATTATCGCTATATGCGCCGCCTGGTCGATACCAAGCCGATGCGAATAGATGCGAATATTCCAGGGCCATTATTGCTCTAAACATCTACATGCCCATTATAGCCGTTGCCTTTAACCAGCTGTAGAAGAAGGTGCTCCGCAAGTCGGCTTTGGCCAGCGCTACAAGGAGTTACAAGGAGTTACGATCTGCCGGCCATGATGAGTTAGCAGATTGCGCCGCACAACATCGGACGTATCTATCACCAAGCGTGCATCCACTTATCGCAGAGCATGATGAATCTACGCTTGGTCTGCAGCAATGAAGTGGCATTCAACCTGCACCT

Full Affymetrix probeset data:

Annotations for 1632283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720