FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632285_at:

>probe:Drosophila_2:1632285_at:426:435; Interrogation_Position=106; Antisense; GAGGTACTGCGTAAGCAGACTTCGT
>probe:Drosophila_2:1632285_at:698:347; Interrogation_Position=120; Antisense; GCAGACTTCGTTGAGCAAACGCCTT
>probe:Drosophila_2:1632285_at:548:421; Interrogation_Position=132; Antisense; GAGCAAACGCCTTTCGGAAACGTCT
>probe:Drosophila_2:1632285_at:511:175; Interrogation_Position=149; Antisense; AAACGTCTTCCATTGAGTATGCCGA
>probe:Drosophila_2:1632285_at:456:625; Interrogation_Position=168; Antisense; TGCCGATAATATACCTGATGAGCTG
>probe:Drosophila_2:1632285_at:102:685; Interrogation_Position=177; Antisense; TATACCTGATGAGCTGACCATACCC
>probe:Drosophila_2:1632285_at:627:609; Interrogation_Position=186; Antisense; TGAGCTGACCATACCCGAAATTGAT
>probe:Drosophila_2:1632285_at:116:607; Interrogation_Position=207; Antisense; TGATGTCGAACGTCTATCATCCCAC
>probe:Drosophila_2:1632285_at:439:647; Interrogation_Position=223; Antisense; TCATCCCACAGTCACACTGAAACTG
>probe:Drosophila_2:1632285_at:166:29; Interrogation_Position=34; Antisense; ATACGAGTGGTAAACGCATTCCGCC
>probe:Drosophila_2:1632285_at:519:197; Interrogation_Position=46; Antisense; AACGCATTCCGCCAGGGTCTGGACG
>probe:Drosophila_2:1632285_at:285:499; Interrogation_Position=62; Antisense; GTCTGGACGCCCGTTACGGTGATCA
>probe:Drosophila_2:1632285_at:86:473; Interrogation_Position=74; Antisense; GTTACGGTGATCACACCAACACATC
>probe:Drosophila_2:1632285_at:74:255; Interrogation_Position=90; Antisense; CAACACATCCCTGGCAGAGGTACTG

Paste this into a BLAST search page for me
GAGGTACTGCGTAAGCAGACTTCGTGCAGACTTCGTTGAGCAAACGCCTTGAGCAAACGCCTTTCGGAAACGTCTAAACGTCTTCCATTGAGTATGCCGATGCCGATAATATACCTGATGAGCTGTATACCTGATGAGCTGACCATACCCTGAGCTGACCATACCCGAAATTGATTGATGTCGAACGTCTATCATCCCACTCATCCCACAGTCACACTGAAACTGATACGAGTGGTAAACGCATTCCGCCAACGCATTCCGCCAGGGTCTGGACGGTCTGGACGCCCGTTACGGTGATCAGTTACGGTGATCACACCAACACATCCAACACATCCCTGGCAGAGGTACTG

Full Affymetrix probeset data:

Annotations for 1632285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720