FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632286_at:

>probe:Drosophila_2:1632286_at:669:3; Interrogation_Position=1046; Antisense; ATTGGGCTTATGGTTGCTCGATGAG
>probe:Drosophila_2:1632286_at:24:445; Interrogation_Position=1065; Antisense; GATGAGCCCTCTGGCGCTCAAAGTG
>probe:Drosophila_2:1632286_at:158:257; Interrogation_Position=1083; Antisense; CAAAGTGAGCCCAGTCTGCTGAATA
>probe:Drosophila_2:1632286_at:227:177; Interrogation_Position=1110; Antisense; AAACTTCGGTCGGTACTGAGTGGCA
>probe:Drosophila_2:1632286_at:299:387; Interrogation_Position=1227; Antisense; GAACAAGTGCATATGACTCAGTCAA
>probe:Drosophila_2:1632286_at:332:231; Interrogation_Position=1250; Antisense; AATGTACGATGTCCAGCCCAGAAAG
>probe:Drosophila_2:1632286_at:400:225; Interrogation_Position=1272; Antisense; AAGGACATAGATGCCCTCCTGGAGG
>probe:Drosophila_2:1632286_at:481:319; Interrogation_Position=1301; Antisense; GCCGAGATCCTTTGGCGATGAACAA
>probe:Drosophila_2:1632286_at:199:443; Interrogation_Position=1317; Antisense; GATGAACAAACCATTAATGCCCTTG
>probe:Drosophila_2:1632286_at:113:235; Interrogation_Position=1332; Antisense; AATGCCCTTGATCAGGCCTACAGAT
>probe:Drosophila_2:1632286_at:347:279; Interrogation_Position=1349; Antisense; CTACAGATCCTGTCTGCAGCAGAAC
>probe:Drosophila_2:1632286_at:588:363; Interrogation_Position=1386; Antisense; GAATACGTGGGAGTTCTTTGCGAGA
>probe:Drosophila_2:1632286_at:252:503; Interrogation_Position=1436; Antisense; GTCGCAGGCGGACTACATCCATAAT
>probe:Drosophila_2:1632286_at:58:33; Interrogation_Position=1456; Antisense; ATAATGTCCAGACACTCTTTGCCCT

Paste this into a BLAST search page for me
ATTGGGCTTATGGTTGCTCGATGAGGATGAGCCCTCTGGCGCTCAAAGTGCAAAGTGAGCCCAGTCTGCTGAATAAAACTTCGGTCGGTACTGAGTGGCAGAACAAGTGCATATGACTCAGTCAAAATGTACGATGTCCAGCCCAGAAAGAAGGACATAGATGCCCTCCTGGAGGGCCGAGATCCTTTGGCGATGAACAAGATGAACAAACCATTAATGCCCTTGAATGCCCTTGATCAGGCCTACAGATCTACAGATCCTGTCTGCAGCAGAACGAATACGTGGGAGTTCTTTGCGAGAGTCGCAGGCGGACTACATCCATAATATAATGTCCAGACACTCTTTGCCCT

Full Affymetrix probeset data:

Annotations for 1632286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720