Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632287_at:

>probe:Drosophila_2:1632287_at:161:525; Interrogation_Position=11106; Antisense; GGGCTTAGTAGGCACTGTCACCAAA
>probe:Drosophila_2:1632287_at:547:387; Interrogation_Position=11161; Antisense; GAAACTGCCAGTGCCGTTCGTGAAA
>probe:Drosophila_2:1632287_at:302:457; Interrogation_Position=11194; Antisense; GATAGTCACAGAAACGCTCCGGAAA
>probe:Drosophila_2:1632287_at:490:385; Interrogation_Position=11220; Antisense; GAAAAGGCTACCCAGATGTGTGACT
>probe:Drosophila_2:1632287_at:694:629; Interrogation_Position=11250; Antisense; TCCTGGTGGTCTTTTGCCATTGTAT
>probe:Drosophila_2:1632287_at:238:627; Interrogation_Position=11264; Antisense; TGCCATTGTATTCCAATCGCCAAAG
>probe:Drosophila_2:1632287_at:655:7; Interrogation_Position=11385; Antisense; ATTGCGCTTGCTGGTTTCTACAGAA
>probe:Drosophila_2:1632287_at:233:367; Interrogation_Position=11417; Antisense; GAATCTTTTCACTAAGCGACGCCAA
>probe:Drosophila_2:1632287_at:489:411; Interrogation_Position=11434; Antisense; GACGCCAATCCAACCATTATGTTTG
>probe:Drosophila_2:1632287_at:234:679; Interrogation_Position=11469; Antisense; TAGTGAGATTCTTTCGTGCCATCCA
>probe:Drosophila_2:1632287_at:252:271; Interrogation_Position=11488; Antisense; CATCCAGTGGTAACGAATGCCGGCA
>probe:Drosophila_2:1632287_at:559:499; Interrogation_Position=11538; Antisense; GTCGGCCAGTCACTACATCGAGATA
>probe:Drosophila_2:1632287_at:515:35; Interrogation_Position=11570; Antisense; ATCTTCCAAAGATTACCAGGCCCAG
>probe:Drosophila_2:1632287_at:402:299; Interrogation_Position=11585; Antisense; CCAGGCCCAGGATACGGTGTCGTTC

Paste this into a BLAST search page for me
GGGCTTAGTAGGCACTGTCACCAAAGAAACTGCCAGTGCCGTTCGTGAAAGATAGTCACAGAAACGCTCCGGAAAGAAAAGGCTACCCAGATGTGTGACTTCCTGGTGGTCTTTTGCCATTGTATTGCCATTGTATTCCAATCGCCAAAGATTGCGCTTGCTGGTTTCTACAGAAGAATCTTTTCACTAAGCGACGCCAAGACGCCAATCCAACCATTATGTTTGTAGTGAGATTCTTTCGTGCCATCCACATCCAGTGGTAACGAATGCCGGCAGTCGGCCAGTCACTACATCGAGATAATCTTCCAAAGATTACCAGGCCCAGCCAGGCCCAGGATACGGTGTCGTTC

Full Affymetrix probeset data:

Annotations for 1632287_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime