FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632288_at:

>probe:Drosophila_2:1632288_at:275:549; Interrogation_Position=1650; Antisense; GGAGGAACACGCGTTCTTCTCATAC
>probe:Drosophila_2:1632288_at:59:703; Interrogation_Position=1706; Antisense; TTTTGCGCGGACATGTGGCCACGAG
>probe:Drosophila_2:1632288_at:214:467; Interrogation_Position=1758; Antisense; GTTGATCGCAAGTTGTCCCCTGAAC
>probe:Drosophila_2:1632288_at:723:613; Interrogation_Position=1778; Antisense; TGAACGCTTCGGAGGGCATGTGCTT
>probe:Drosophila_2:1632288_at:325:621; Interrogation_Position=1802; Antisense; TGCTGGTAGGCATTGTCCCGGTAAG
>probe:Drosophila_2:1632288_at:33:639; Interrogation_Position=1823; Antisense; TAAGGGAAGACTCTCCGCGAAACTT
>probe:Drosophila_2:1632288_at:236:323; Interrogation_Position=1839; Antisense; GCGAAACTTCTTTGGCAAGGCCTTC
>probe:Drosophila_2:1632288_at:716:433; Interrogation_Position=1881; Antisense; GAGTGGAGTCGCTCTATTGCAGGAC
>probe:Drosophila_2:1632288_at:249:7; Interrogation_Position=1896; Antisense; ATTGCAGGACTTTTTCGAGCCAGCG
>probe:Drosophila_2:1632288_at:577:649; Interrogation_Position=1967; Antisense; TCACGGTGCTGTTAGCCTAATCCAC
>probe:Drosophila_2:1632288_at:711:157; Interrogation_Position=2018; Antisense; ACACATCCCTGCTCAATCATATTAT
>probe:Drosophila_2:1632288_at:537:339; Interrogation_Position=2050; Antisense; GCTAGTTTTATATCGCGAGACCTCA
>probe:Drosophila_2:1632288_at:658:423; Interrogation_Position=2066; Antisense; GAGACCTCACGTGTACACTTAGTTT
>probe:Drosophila_2:1632288_at:172:31; Interrogation_Position=2131; Antisense; ATAACTTTATCATTGCTCCCAGGAC

Paste this into a BLAST search page for me
GGAGGAACACGCGTTCTTCTCATACTTTTGCGCGGACATGTGGCCACGAGGTTGATCGCAAGTTGTCCCCTGAACTGAACGCTTCGGAGGGCATGTGCTTTGCTGGTAGGCATTGTCCCGGTAAGTAAGGGAAGACTCTCCGCGAAACTTGCGAAACTTCTTTGGCAAGGCCTTCGAGTGGAGTCGCTCTATTGCAGGACATTGCAGGACTTTTTCGAGCCAGCGTCACGGTGCTGTTAGCCTAATCCACACACATCCCTGCTCAATCATATTATGCTAGTTTTATATCGCGAGACCTCAGAGACCTCACGTGTACACTTAGTTTATAACTTTATCATTGCTCCCAGGAC

Full Affymetrix probeset data:

Annotations for 1632288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720