FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632289_at:

>probe:Drosophila_2:1632289_at:503:235; Interrogation_Position=105; Antisense; AATCCATTCTGGTGCTCCAGCGGCA
>probe:Drosophila_2:1632289_at:51:331; Interrogation_Position=124; Antisense; GCGGCAGTCATTTCGCAAGGACAAC
>probe:Drosophila_2:1632289_at:602:67; Interrogation_Position=13; Antisense; ATGGCAGTCGGCTTCATTGTAATCT
>probe:Drosophila_2:1632289_at:360:177; Interrogation_Position=146; Antisense; AACAGTCTGTGTCCCAGTCCGTTGG
>probe:Drosophila_2:1632289_at:656:465; Interrogation_Position=166; Antisense; GTTGGTTCTGCTTACGGTCAAGACC
>probe:Drosophila_2:1632289_at:67:593; Interrogation_Position=201; Antisense; TGGTGCACGACCCTATTGGGCTGCA
>probe:Drosophila_2:1632289_at:561:5; Interrogation_Position=28; Antisense; ATTGTAATCTTCAGCGCCATATTCG
>probe:Drosophila_2:1632289_at:342:261; Interrogation_Position=341; Antisense; CAGCCGTGGTGGTTCCTGCTTTGGT
>probe:Drosophila_2:1632289_at:599:691; Interrogation_Position=360; Antisense; TTTGGTGGTTGCTCCTATTCGCCAG
>probe:Drosophila_2:1632289_at:638:501; Interrogation_Position=400; Antisense; GTCCCAGCCGTTGTAGGAGCTAGTC
>probe:Drosophila_2:1632289_at:722:393; Interrogation_Position=428; Antisense; GAAATGTGTACCATGGTCGCCATCA
>probe:Drosophila_2:1632289_at:352:305; Interrogation_Position=54; Antisense; CCTGGCCCAAGGATCAAATCTTTTG
>probe:Drosophila_2:1632289_at:728:163; Interrogation_Position=69; Antisense; AAATCTTTTGCCCATTGAGCAGCAA
>probe:Drosophila_2:1632289_at:81:363; Interrogation_Position=90; Antisense; GCAATCGGAGGTGCCAATCCATTCT

Paste this into a BLAST search page for me
AATCCATTCTGGTGCTCCAGCGGCAGCGGCAGTCATTTCGCAAGGACAACATGGCAGTCGGCTTCATTGTAATCTAACAGTCTGTGTCCCAGTCCGTTGGGTTGGTTCTGCTTACGGTCAAGACCTGGTGCACGACCCTATTGGGCTGCAATTGTAATCTTCAGCGCCATATTCGCAGCCGTGGTGGTTCCTGCTTTGGTTTTGGTGGTTGCTCCTATTCGCCAGGTCCCAGCCGTTGTAGGAGCTAGTCGAAATGTGTACCATGGTCGCCATCACCTGGCCCAAGGATCAAATCTTTTGAAATCTTTTGCCCATTGAGCAGCAAGCAATCGGAGGTGCCAATCCATTCT

Full Affymetrix probeset data:

Annotations for 1632289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720