Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632291_at:

>probe:Drosophila_2:1632291_at:589:395; Interrogation_Position=1482; Antisense; GAAATCTGTATCCACTACTATAATA
>probe:Drosophila_2:1632291_at:148:709; Interrogation_Position=1555; Antisense; TTAACTAAAGAGTCCCTGGTAGCGA
>probe:Drosophila_2:1632291_at:362:15; Interrogation_Position=1597; Antisense; ATTATAATTCCATTTAGTGCACTGA
>probe:Drosophila_2:1632291_at:629:463; Interrogation_Position=1645; Antisense; GATTGTACGCATATACACAACCTAC
>probe:Drosophila_2:1632291_at:16:273; Interrogation_Position=1694; Antisense; CATTACCGATTACCCCGATAAATAT
>probe:Drosophila_2:1632291_at:521:485; Interrogation_Position=1802; Antisense; GTAGATCAACATGTACGAGCGAATT
>probe:Drosophila_2:1632291_at:107:679; Interrogation_Position=1845; Antisense; TTACGACGGAGCGACGAAGATTACG
>probe:Drosophila_2:1632291_at:215:215; Interrogation_Position=1861; Antisense; AAGATTACGCGGTCGTCGAGGCCGA
>probe:Drosophila_2:1632291_at:722:723; Interrogation_Position=1918; Antisense; TTGAATGAAGATCTCCAGGAAACAC
>probe:Drosophila_2:1632291_at:34:143; Interrogation_Position=1951; Antisense; ACTGAAACCTGACCCAACACATTTA
>probe:Drosophila_2:1632291_at:478:357; Interrogation_Position=1988; Antisense; GCAAAGATCCTGGTAATGCCTCTAT
>probe:Drosophila_2:1632291_at:180:235; Interrogation_Position=2002; Antisense; AATGCCTCTATGCAAGCGTTACCAC
>probe:Drosophila_2:1632291_at:706:321; Interrogation_Position=2017; Antisense; GCGTTACCACGGATATTTCCAATTC
>probe:Drosophila_2:1632291_at:471:473; Interrogation_Position=2057; Antisense; GTTAACGCTTGGATTAATCCTGTCA

Paste this into a BLAST search page for me
GAAATCTGTATCCACTACTATAATATTAACTAAAGAGTCCCTGGTAGCGAATTATAATTCCATTTAGTGCACTGAGATTGTACGCATATACACAACCTACCATTACCGATTACCCCGATAAATATGTAGATCAACATGTACGAGCGAATTTTACGACGGAGCGACGAAGATTACGAAGATTACGCGGTCGTCGAGGCCGATTGAATGAAGATCTCCAGGAAACACACTGAAACCTGACCCAACACATTTAGCAAAGATCCTGGTAATGCCTCTATAATGCCTCTATGCAAGCGTTACCACGCGTTACCACGGATATTTCCAATTCGTTAACGCTTGGATTAATCCTGTCA

Full Affymetrix probeset data:

Annotations for 1632291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime