FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632292_at:

>probe:Drosophila_2:1632292_at:699:93; Interrogation_Position=1353; Antisense; AGTTCCAGCTGGTAGGATCCACACC
>probe:Drosophila_2:1632292_at:728:7; Interrogation_Position=1379; Antisense; ATTGCCAATCGTGACTGCTATGCCT
>probe:Drosophila_2:1632292_at:187:333; Interrogation_Position=1429; Antisense; GCTGGACCTCTCCAATCAGGGTAGC
>probe:Drosophila_2:1632292_at:266:247; Interrogation_Position=1466; Antisense; AATTCCACGCCATTGAACACAAACC
>probe:Drosophila_2:1632292_at:663:173; Interrogation_Position=1486; Antisense; AAACCAAGGCAAATCCCGTCTGGAT
>probe:Drosophila_2:1632292_at:237:45; Interrogation_Position=1498; Antisense; ATCCCGTCTGGATTTGCTAAAGAAT
>probe:Drosophila_2:1632292_at:512:525; Interrogation_Position=1537; Antisense; GGGCAGGTACGTTCATGTACACGAT
>probe:Drosophila_2:1632292_at:164:139; Interrogation_Position=1557; Antisense; ACGATTTCGAGAGTCCGTGTTCCGC
>probe:Drosophila_2:1632292_at:451:1; Interrogation_Position=1612; Antisense; ATCGTTCCGACGCAAAAAGCTCTTC
>probe:Drosophila_2:1632292_at:243:179; Interrogation_Position=1625; Antisense; AAAAAGCTCTTCGTCCTGGAATATG
>probe:Drosophila_2:1632292_at:132:535; Interrogation_Position=1669; Antisense; GGTGCCAGCGAGCAACGTAAACCGA
>probe:Drosophila_2:1632292_at:18:461; Interrogation_Position=1781; Antisense; GATTAGTTCTAGACCGTAGTGTTGT
>probe:Drosophila_2:1632292_at:622:485; Interrogation_Position=1796; Antisense; GTAGTGTTGTACGAAGTTCCCTAGA
>probe:Drosophila_2:1632292_at:414:373; Interrogation_Position=1808; Antisense; GAAGTTCCCTAGATATAGTCTTACG

Paste this into a BLAST search page for me
AGTTCCAGCTGGTAGGATCCACACCATTGCCAATCGTGACTGCTATGCCTGCTGGACCTCTCCAATCAGGGTAGCAATTCCACGCCATTGAACACAAACCAAACCAAGGCAAATCCCGTCTGGATATCCCGTCTGGATTTGCTAAAGAATGGGCAGGTACGTTCATGTACACGATACGATTTCGAGAGTCCGTGTTCCGCATCGTTCCGACGCAAAAAGCTCTTCAAAAAGCTCTTCGTCCTGGAATATGGGTGCCAGCGAGCAACGTAAACCGAGATTAGTTCTAGACCGTAGTGTTGTGTAGTGTTGTACGAAGTTCCCTAGAGAAGTTCCCTAGATATAGTCTTACG

Full Affymetrix probeset data:

Annotations for 1632292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720