FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632293_at:

>probe:Drosophila_2:1632293_at:397:707; Interrogation_Position=1570; Antisense; TTCATTCCGCAATCGAAGAACCTGG
>probe:Drosophila_2:1632293_at:565:121; Interrogation_Position=1613; Antisense; AGCGGTGCATCCTGAGCAACCGGAT
>probe:Drosophila_2:1632293_at:578:441; Interrogation_Position=1635; Antisense; GATGTACACGATGCAGAGTCCCCTG
>probe:Drosophila_2:1632293_at:707:695; Interrogation_Position=1678; Antisense; TTTCCCAACAACGTTTTCAGCAGTC
>probe:Drosophila_2:1632293_at:98:649; Interrogation_Position=1694; Antisense; TCAGCAGTCCGGTGCAGATGATCAT
>probe:Drosophila_2:1632293_at:598:461; Interrogation_Position=1727; Antisense; GATTCCCCTTTCTCTTCGAGATGAA
>probe:Drosophila_2:1632293_at:648:425; Interrogation_Position=1744; Antisense; GAGATGAACAGCATCATCCGCCTCA
>probe:Drosophila_2:1632293_at:599:87; Interrogation_Position=1793; Antisense; AGATCGACGCGGACTTTAGGTACAA
>probe:Drosophila_2:1632293_at:432:177; Interrogation_Position=1865; Antisense; AAACGGCTATCGTCCTGACCACGGA
>probe:Drosophila_2:1632293_at:73:611; Interrogation_Position=1880; Antisense; TGACCACGGAGCACCTGAAGGGACC
>probe:Drosophila_2:1632293_at:370:321; Interrogation_Position=1939; Antisense; GCCCTCACGTTCATTGGCGAGCTAA
>probe:Drosophila_2:1632293_at:615:99; Interrogation_Position=1972; Antisense; AGATGGCGAACCCAGCTGGTCAGCA
>probe:Drosophila_2:1632293_at:543:91; Interrogation_Position=2085; Antisense; AGTTCAAGTGGCTCCAGTCGTTCGA
>probe:Drosophila_2:1632293_at:636:431; Interrogation_Position=2101; Antisense; GTCGTTCGATTTACGCCAGTCAAAC

Paste this into a BLAST search page for me
TTCATTCCGCAATCGAAGAACCTGGAGCGGTGCATCCTGAGCAACCGGATGATGTACACGATGCAGAGTCCCCTGTTTCCCAACAACGTTTTCAGCAGTCTCAGCAGTCCGGTGCAGATGATCATGATTCCCCTTTCTCTTCGAGATGAAGAGATGAACAGCATCATCCGCCTCAAGATCGACGCGGACTTTAGGTACAAAAACGGCTATCGTCCTGACCACGGATGACCACGGAGCACCTGAAGGGACCGCCCTCACGTTCATTGGCGAGCTAAAGATGGCGAACCCAGCTGGTCAGCAAGTTCAAGTGGCTCCAGTCGTTCGAGTCGTTCGATTTACGCCAGTCAAAC

Full Affymetrix probeset data:

Annotations for 1632293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720