FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632294_at:

>probe:Drosophila_2:1632294_at:256:681; Interrogation_Position=1864; Antisense; TAGGCGGCAATCTCTGATCCAGGAG
>probe:Drosophila_2:1632294_at:221:551; Interrogation_Position=1885; Antisense; GGAGATCCCAGTATTAGCTAAGCAG
>probe:Drosophila_2:1632294_at:558:117; Interrogation_Position=1900; Antisense; AGCTAAGCAGGACGAGACACACACT
>probe:Drosophila_2:1632294_at:685:587; Interrogation_Position=1965; Antisense; TGGAGCAGATCACAGTTGGCCCTAA
>probe:Drosophila_2:1632294_at:373:343; Interrogation_Position=1979; Antisense; GTTGGCCCTAAGTCTAAGTCGTTGC
>probe:Drosophila_2:1632294_at:42:499; Interrogation_Position=1990; Antisense; GTCTAAGTCGTTGCTATGAAGCCAA
>probe:Drosophila_2:1632294_at:10:601; Interrogation_Position=2024; Antisense; TGTTTAGGCCTTCGCAAAGATTTAC
>probe:Drosophila_2:1632294_at:533:215; Interrogation_Position=2084; Antisense; AAGATACTGCCTTAAGTCTGTACAT
>probe:Drosophila_2:1632294_at:27:219; Interrogation_Position=2097; Antisense; AAGTCTGTACATAGTTATCCCAAAC
>probe:Drosophila_2:1632294_at:724:25; Interrogation_Position=2135; Antisense; ATAGCCGTTAAACCCTAGCTTAATG
>probe:Drosophila_2:1632294_at:680:565; Interrogation_Position=2218; Antisense; GGCAGCTAAACGTACCAAAGAACAA
>probe:Drosophila_2:1632294_at:74:163; Interrogation_Position=2251; Antisense; AAATGAACTACCACTTGGCGACCAC
>probe:Drosophila_2:1632294_at:695:579; Interrogation_Position=2266; Antisense; TGGCGACCACTTGTCTAAATTTAGT
>probe:Drosophila_2:1632294_at:676:567; Interrogation_Position=2317; Antisense; GGCATCACCCACATTTATTTATACG

Paste this into a BLAST search page for me
TAGGCGGCAATCTCTGATCCAGGAGGGAGATCCCAGTATTAGCTAAGCAGAGCTAAGCAGGACGAGACACACACTTGGAGCAGATCACAGTTGGCCCTAAGTTGGCCCTAAGTCTAAGTCGTTGCGTCTAAGTCGTTGCTATGAAGCCAATGTTTAGGCCTTCGCAAAGATTTACAAGATACTGCCTTAAGTCTGTACATAAGTCTGTACATAGTTATCCCAAACATAGCCGTTAAACCCTAGCTTAATGGGCAGCTAAACGTACCAAAGAACAAAAATGAACTACCACTTGGCGACCACTGGCGACCACTTGTCTAAATTTAGTGGCATCACCCACATTTATTTATACG

Full Affymetrix probeset data:

Annotations for 1632294_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720