Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632297_at:

>probe:Drosophila_2:1632297_at:469:81; Interrogation_Position=5677; Antisense; AGGGACGACCCAAGGACCTGCGCGA
>probe:Drosophila_2:1632297_at:159:523; Interrogation_Position=5706; Antisense; GTGGCCAACGCCTATACCATAGTGA
>probe:Drosophila_2:1632297_at:514:425; Interrogation_Position=5731; Antisense; GAGAGGGCATCAACGAATCGGCCAA
>probe:Drosophila_2:1632297_at:427:365; Interrogation_Position=5745; Antisense; GAATCGGCCAACACACTCATCGAAG
>probe:Drosophila_2:1632297_at:257:315; Interrogation_Position=5772; Antisense; GCCATCACGGAGCACGACCAGAAGG
>probe:Drosophila_2:1632297_at:439:213; Interrogation_Position=5901; Antisense; AAGAGCTCGCTGATTCCGGAGGCCA
>probe:Drosophila_2:1632297_at:489:551; Interrogation_Position=5954; Antisense; GGAGATCCACTAGGCAACTGCTTCA
>probe:Drosophila_2:1632297_at:629:141; Interrogation_Position=5970; Antisense; ACTGCTTCACAGATCGACTAGGTTA
>probe:Drosophila_2:1632297_at:365:367; Interrogation_Position=5991; Antisense; GTTAACGGTAGCTATAGTTCACGGG
>probe:Drosophila_2:1632297_at:272:525; Interrogation_Position=6014; Antisense; GGGCTTACAGCATAACGCAATGTTT
>probe:Drosophila_2:1632297_at:289:169; Interrogation_Position=6073; Antisense; AAAGGAGCACTTGCACGAGACGGCG
>probe:Drosophila_2:1632297_at:682:721; Interrogation_Position=6112; Antisense; TTGGGATCCCGAACGGTGATTCCGA
>probe:Drosophila_2:1632297_at:166:141; Interrogation_Position=6124; Antisense; ACGGTGATTCCGACATGGGTGTGAT
>probe:Drosophila_2:1632297_at:57:465; Interrogation_Position=6146; Antisense; GATTGAACTTATCCTTTTTAGCCAT

Paste this into a BLAST search page for me
AGGGACGACCCAAGGACCTGCGCGAGTGGCCAACGCCTATACCATAGTGAGAGAGGGCATCAACGAATCGGCCAAGAATCGGCCAACACACTCATCGAAGGCCATCACGGAGCACGACCAGAAGGAAGAGCTCGCTGATTCCGGAGGCCAGGAGATCCACTAGGCAACTGCTTCAACTGCTTCACAGATCGACTAGGTTAGTTAACGGTAGCTATAGTTCACGGGGGGCTTACAGCATAACGCAATGTTTAAAGGAGCACTTGCACGAGACGGCGTTGGGATCCCGAACGGTGATTCCGAACGGTGATTCCGACATGGGTGTGATGATTGAACTTATCCTTTTTAGCCAT

Full Affymetrix probeset data:

Annotations for 1632297_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime