Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632301_at:

>probe:Drosophila_2:1632301_at:393:59; Interrogation_Position=1434; Antisense; ATGATCAGCACCATGAGCCCGATTG
>probe:Drosophila_2:1632301_at:525:463; Interrogation_Position=1454; Antisense; GATTGCAATACCAATGCCGGCGCCA
>probe:Drosophila_2:1632301_at:661:653; Interrogation_Position=1493; Antisense; TAATGTTCCGGGTCAAGGTGCTGAA
>probe:Drosophila_2:1632301_at:91:431; Interrogation_Position=1539; Antisense; GAGGCGACCCTTATTAACCTGGACG
>probe:Drosophila_2:1632301_at:114:203; Interrogation_Position=1571; Antisense; AACCACGTCTTCGATGGCCTAGACA
>probe:Drosophila_2:1632301_at:379:459; Interrogation_Position=1649; Antisense; GATTTACGCCCATGTTTTGTATGAT
>probe:Drosophila_2:1632301_at:585:603; Interrogation_Position=1670; Antisense; TGATTCTGCATCAAGTACGTACCCC
>probe:Drosophila_2:1632301_at:176:301; Interrogation_Position=1694; Antisense; CCCATCAGTGTTCCCATTTTGTAAT
>probe:Drosophila_2:1632301_at:337:599; Interrogation_Position=1713; Antisense; TGTAATTACCGTTCGTGTGTTTCGT
>probe:Drosophila_2:1632301_at:517:517; Interrogation_Position=1727; Antisense; GTGTGTTTCGTAGTGTCCTGTAGAC
>probe:Drosophila_2:1632301_at:208:677; Interrogation_Position=1747; Antisense; TAGACTTACGCTTGCTTGCTGCGCA
>probe:Drosophila_2:1632301_at:207:427; Interrogation_Position=1810; Antisense; GAGATCAGCCTAAACCAATACCTTC
>probe:Drosophila_2:1632301_at:186:417; Interrogation_Position=1855; Antisense; GAGCCCTTACATAGATGCATACTTT
>probe:Drosophila_2:1632301_at:696:345; Interrogation_Position=1871; Antisense; GCATACTTTCTGTTGTAGTCCTTAC

Paste this into a BLAST search page for me
ATGATCAGCACCATGAGCCCGATTGGATTGCAATACCAATGCCGGCGCCATAATGTTCCGGGTCAAGGTGCTGAAGAGGCGACCCTTATTAACCTGGACGAACCACGTCTTCGATGGCCTAGACAGATTTACGCCCATGTTTTGTATGATTGATTCTGCATCAAGTACGTACCCCCCCATCAGTGTTCCCATTTTGTAATTGTAATTACCGTTCGTGTGTTTCGTGTGTGTTTCGTAGTGTCCTGTAGACTAGACTTACGCTTGCTTGCTGCGCAGAGATCAGCCTAAACCAATACCTTCGAGCCCTTACATAGATGCATACTTTGCATACTTTCTGTTGTAGTCCTTAC

Full Affymetrix probeset data:

Annotations for 1632301_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime