Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632304_at:

>probe:Drosophila_2:1632304_at:308:301; Interrogation_Position=2355; Antisense; CCCCTTAATTGTGCAGAATCTCTTT
>probe:Drosophila_2:1632304_at:152:729; Interrogation_Position=2363; Antisense; TTGTGCAGAATCTCTTTGCTAATCT
>probe:Drosophila_2:1632304_at:335:367; Interrogation_Position=2370; Antisense; GAATCTCTTTGCTAATCTGAAACAG
>probe:Drosophila_2:1632304_at:20:41; Interrogation_Position=2384; Antisense; ATCTGAAACAGCCAATGCGCCCTTA
>probe:Drosophila_2:1632304_at:307:127; Interrogation_Position=2393; Antisense; AGCCAATGCGCCCTTACTGTAAGTA
>probe:Drosophila_2:1632304_at:264:47; Interrogation_Position=2398; Antisense; ATGCGCCCTTACTGTAAGTAGATGT
>probe:Drosophila_2:1632304_at:235:217; Interrogation_Position=2413; Antisense; AAGTAGATGTAGCTTTCAGTTCTCA
>probe:Drosophila_2:1632304_at:396:443; Interrogation_Position=2418; Antisense; GATGTAGCTTTCAGTTCTCAGTCTC
>probe:Drosophila_2:1632304_at:320:675; Interrogation_Position=2422; Antisense; TAGCTTTCAGTTCTCAGTCTCTAAC
>probe:Drosophila_2:1632304_at:516:715; Interrogation_Position=2432; Antisense; TTCTCAGTCTCTAACCGCATTGTGT
>probe:Drosophila_2:1632304_at:160:83; Interrogation_Position=2437; Antisense; AGTCTCTAACCGCATTGTGTTTGGT
>probe:Drosophila_2:1632304_at:142:275; Interrogation_Position=2449; Antisense; CATTGTGTTTGGTTCTCTTTGCAGG
>probe:Drosophila_2:1632304_at:394:599; Interrogation_Position=2454; Antisense; TGTTTGGTTCTCTTTGCAGGTTTGA
>probe:Drosophila_2:1632304_at:335:643; Interrogation_Position=2462; Antisense; TCTCTTTGCAGGTTTGAGGGCTACA

Paste this into a BLAST search page for me
CCCCTTAATTGTGCAGAATCTCTTTTTGTGCAGAATCTCTTTGCTAATCTGAATCTCTTTGCTAATCTGAAACAGATCTGAAACAGCCAATGCGCCCTTAAGCCAATGCGCCCTTACTGTAAGTAATGCGCCCTTACTGTAAGTAGATGTAAGTAGATGTAGCTTTCAGTTCTCAGATGTAGCTTTCAGTTCTCAGTCTCTAGCTTTCAGTTCTCAGTCTCTAACTTCTCAGTCTCTAACCGCATTGTGTAGTCTCTAACCGCATTGTGTTTGGTCATTGTGTTTGGTTCTCTTTGCAGGTGTTTGGTTCTCTTTGCAGGTTTGATCTCTTTGCAGGTTTGAGGGCTACA

Full Affymetrix probeset data:

Annotations for 1632304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime