Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632306_at:

>probe:Drosophila_2:1632306_at:371:617; Interrogation_Position=2624; Antisense; TGCAGTTCGTGGTGTGCGCCCTCAT
>probe:Drosophila_2:1632306_at:152:39; Interrogation_Position=2647; Antisense; ATCTACGTCTGGGTGACGCGACTCA
>probe:Drosophila_2:1632306_at:473:141; Interrogation_Position=2686; Antisense; ACTGGGCCGTGATGAACTGCCAGCA
>probe:Drosophila_2:1632306_at:527:627; Interrogation_Position=2703; Antisense; TGCCAGCAGGCATTTACCCAATCAA
>probe:Drosophila_2:1632306_at:119:655; Interrogation_Position=2729; Antisense; TAATCTCCATTATATGTGCTCGATG
>probe:Drosophila_2:1632306_at:412:33; Interrogation_Position=2763; Antisense; ATGCAATGTGTATCCCGTAAACCCA
>probe:Drosophila_2:1632306_at:560:663; Interrogation_Position=2780; Antisense; TAAACCCATTTTTTGTGCTCCTCCA
>probe:Drosophila_2:1632306_at:501:597; Interrogation_Position=2793; Antisense; TGTGCTCCTCCAAACTTGGATCGTA
>probe:Drosophila_2:1632306_at:720:147; Interrogation_Position=2905; Antisense; ACTTCTGCAACCGATCATCTATAAT
>probe:Drosophila_2:1632306_at:593:159; Interrogation_Position=2934; Antisense; ACAACTCTCCTAAAGGGTGCTCCAT
>probe:Drosophila_2:1632306_at:576:531; Interrogation_Position=2948; Antisense; GGGTGCTCCATCAGGACAGATACGA
>probe:Drosophila_2:1632306_at:570:415; Interrogation_Position=3082; Antisense; GAGCGACTGCTTCAAATTCGAATCT
>probe:Drosophila_2:1632306_at:657:717; Interrogation_Position=3098; Antisense; TTCGAATCTGTCCTGTTGCATGCAA
>probe:Drosophila_2:1632306_at:585:57; Interrogation_Position=3140; Antisense; ATGATACGCCTTGTTGCAACCAGTA

Paste this into a BLAST search page for me
TGCAGTTCGTGGTGTGCGCCCTCATATCTACGTCTGGGTGACGCGACTCAACTGGGCCGTGATGAACTGCCAGCATGCCAGCAGGCATTTACCCAATCAATAATCTCCATTATATGTGCTCGATGATGCAATGTGTATCCCGTAAACCCATAAACCCATTTTTTGTGCTCCTCCATGTGCTCCTCCAAACTTGGATCGTAACTTCTGCAACCGATCATCTATAATACAACTCTCCTAAAGGGTGCTCCATGGGTGCTCCATCAGGACAGATACGAGAGCGACTGCTTCAAATTCGAATCTTTCGAATCTGTCCTGTTGCATGCAAATGATACGCCTTGTTGCAACCAGTA

Full Affymetrix probeset data:

Annotations for 1632306_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime