FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632308_at:

>probe:Drosophila_2:1632308_at:471:429; Interrogation_Position=1854; Antisense; GAGTTCTTCATCCATTTATCTTTCG
>probe:Drosophila_2:1632308_at:179:69; Interrogation_Position=1889; Antisense; ATGGCTCCTCCATGGCTGAAGCTTA
>probe:Drosophila_2:1632308_at:479:205; Interrogation_Position=1907; Antisense; AAGCTTATGTGCGAGCTGCAGCATA
>probe:Drosophila_2:1632308_at:663:249; Interrogation_Position=1953; Antisense; CAAGATCTACCATCGACTTCTGTTT
>probe:Drosophila_2:1632308_at:485:149; Interrogation_Position=1968; Antisense; ACTTCTGTTTTGTGAGACCGCAGCA
>probe:Drosophila_2:1632308_at:74:21; Interrogation_Position=1992; Antisense; ATATTCCGGCCGTAAACGCATTACT
>probe:Drosophila_2:1632308_at:589:433; Interrogation_Position=2051; Antisense; GAGTGTTTGAGCTACCCGGACTACA
>probe:Drosophila_2:1632308_at:188:389; Interrogation_Position=2095; Antisense; GAAACTGGTCATCGGTTGCGGATTC
>probe:Drosophila_2:1632308_at:315:677; Interrogation_Position=2121; Antisense; TAGTGCCCGACGTAGGTTACAACGA
>probe:Drosophila_2:1632308_at:542:667; Interrogation_Position=2150; Antisense; TACATCTCATTCATGGCGGTGCGGC
>probe:Drosophila_2:1632308_at:314:347; Interrogation_Position=2193; Antisense; GCATCGCCAGCTTCATGTTATATCA
>probe:Drosophila_2:1632308_at:88:477; Interrogation_Position=2209; Antisense; GTTATATCACCTTATCCAGACATGT
>probe:Drosophila_2:1632308_at:324:135; Interrogation_Position=2271; Antisense; ACGCGGCCGTCATGTTGTACCAGAA
>probe:Drosophila_2:1632308_at:189:705; Interrogation_Position=2332; Antisense; TTATGACAAGTATCTGCCTCTGGAC

Paste this into a BLAST search page for me
GAGTTCTTCATCCATTTATCTTTCGATGGCTCCTCCATGGCTGAAGCTTAAAGCTTATGTGCGAGCTGCAGCATACAAGATCTACCATCGACTTCTGTTTACTTCTGTTTTGTGAGACCGCAGCAATATTCCGGCCGTAAACGCATTACTGAGTGTTTGAGCTACCCGGACTACAGAAACTGGTCATCGGTTGCGGATTCTAGTGCCCGACGTAGGTTACAACGATACATCTCATTCATGGCGGTGCGGCGCATCGCCAGCTTCATGTTATATCAGTTATATCACCTTATCCAGACATGTACGCGGCCGTCATGTTGTACCAGAATTATGACAAGTATCTGCCTCTGGAC

Full Affymetrix probeset data:

Annotations for 1632308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720