FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632309_at:

>probe:Drosophila_2:1632309_at:66:207; Interrogation_Position=3090; Antisense; AAGCTGCTCGAATTCACGACGGGAT
>probe:Drosophila_2:1632309_at:438:611; Interrogation_Position=3139; Antisense; TGAAATGCCTGCGTCTGCTAATCAC
>probe:Drosophila_2:1632309_at:277:655; Interrogation_Position=3157; Antisense; TAATCACGCGTCACGGTCCGGATAG
>probe:Drosophila_2:1632309_at:4:503; Interrogation_Position=3172; Antisense; GTCCGGATAGCGATCGGTTGCCTAC
>probe:Drosophila_2:1632309_at:313:443; Interrogation_Position=3266; Antisense; GATGAAGGCCATCAACTACTCGAAG
>probe:Drosophila_2:1632309_at:7:221; Interrogation_Position=3288; Antisense; AAGGGCTTCGGCATGCTGTAGACTA
>probe:Drosophila_2:1632309_at:507:403; Interrogation_Position=3308; Antisense; GACTATGGTCCAAACTGCAAGTGCA
>probe:Drosophila_2:1632309_at:617:361; Interrogation_Position=3324; Antisense; GCAAGTGCAAGTCTGTCATCTGGAA
>probe:Drosophila_2:1632309_at:600:671; Interrogation_Position=3353; Antisense; TACCACCACCTCTCTGGGAAGAAGA
>probe:Drosophila_2:1632309_at:298:693; Interrogation_Position=3397; Antisense; TTTGAGTTCGTTTTGGGTTCTGCCA
>probe:Drosophila_2:1632309_at:190:343; Interrogation_Position=3511; Antisense; GACCGAACGGACACGCGATTTTGTT
>probe:Drosophila_2:1632309_at:446:715; Interrogation_Position=3535; Antisense; TTCCCTTCTTTAGCCCAGTTAATTG
>probe:Drosophila_2:1632309_at:716:149; Interrogation_Position=3573; Antisense; ACATAAACACGCCACATACTACATT
>probe:Drosophila_2:1632309_at:161:267; Interrogation_Position=3637; Antisense; CAGTACGCGCTGAATATTTTCCTAA

Paste this into a BLAST search page for me
AAGCTGCTCGAATTCACGACGGGATTGAAATGCCTGCGTCTGCTAATCACTAATCACGCGTCACGGTCCGGATAGGTCCGGATAGCGATCGGTTGCCTACGATGAAGGCCATCAACTACTCGAAGAAGGGCTTCGGCATGCTGTAGACTAGACTATGGTCCAAACTGCAAGTGCAGCAAGTGCAAGTCTGTCATCTGGAATACCACCACCTCTCTGGGAAGAAGATTTGAGTTCGTTTTGGGTTCTGCCAGACCGAACGGACACGCGATTTTGTTTTCCCTTCTTTAGCCCAGTTAATTGACATAAACACGCCACATACTACATTCAGTACGCGCTGAATATTTTCCTAA

Full Affymetrix probeset data:

Annotations for 1632309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720