FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632313_at:

>probe:Drosophila_2:1632313_at:508:637; Interrogation_Position=1196; Antisense; TCGGTGACGGCCATCTATTGCCATC
>probe:Drosophila_2:1632313_at:236:9; Interrogation_Position=1212; Antisense; ATTGCCATCCCATTGAGCACATCTT
>probe:Drosophila_2:1632313_at:307:421; Interrogation_Position=1226; Antisense; GAGCACATCTTTAGCAACCTGTTGC
>probe:Drosophila_2:1632313_at:714:523; Interrogation_Position=1261; Antisense; GGGCGTCTTTCTCATGGGCAGCCAT
>probe:Drosophila_2:1632313_at:696:437; Interrogation_Position=1376; Antisense; GAGGCGCATGATTTTCACCATTTAA
>probe:Drosophila_2:1632313_at:298:711; Interrogation_Position=1403; Antisense; TTCAACAACTGTTTCGGCGTGCTGG
>probe:Drosophila_2:1632313_at:220:699; Interrogation_Position=1461; Antisense; TTTTCCGGGCCACCAAGTCGTATGC
>probe:Drosophila_2:1632313_at:699:483; Interrogation_Position=1480; Antisense; GTATGCGCGACACATCATGATGCTG
>probe:Drosophila_2:1632313_at:473:9; Interrogation_Position=1528; Antisense; ATTCCCCGATCCGACGATGAAGTAA
>probe:Drosophila_2:1632313_at:422:511; Interrogation_Position=1562; Antisense; GTGAAAGTTCTCTTGTGCATGGGCA
>probe:Drosophila_2:1632313_at:83:349; Interrogation_Position=1578; Antisense; GCATGGGCAGCAAGCATTTCTCAAT
>probe:Drosophila_2:1632313_at:39:727; Interrogation_Position=1622; Antisense; TTGTGATATGACCAGGCAGATCCTA
>probe:Drosophila_2:1632313_at:318:351; Interrogation_Position=1637; Antisense; GCAGATCCTATTTTGTACACCTCAT
>probe:Drosophila_2:1632313_at:94:679; Interrogation_Position=1671; Antisense; TATGGTGCAGACACACCCCTAGTAT

Paste this into a BLAST search page for me
TCGGTGACGGCCATCTATTGCCATCATTGCCATCCCATTGAGCACATCTTGAGCACATCTTTAGCAACCTGTTGCGGGCGTCTTTCTCATGGGCAGCCATGAGGCGCATGATTTTCACCATTTAATTCAACAACTGTTTCGGCGTGCTGGTTTTCCGGGCCACCAAGTCGTATGCGTATGCGCGACACATCATGATGCTGATTCCCCGATCCGACGATGAAGTAAGTGAAAGTTCTCTTGTGCATGGGCAGCATGGGCAGCAAGCATTTCTCAATTTGTGATATGACCAGGCAGATCCTAGCAGATCCTATTTTGTACACCTCATTATGGTGCAGACACACCCCTAGTAT

Full Affymetrix probeset data:

Annotations for 1632313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720