FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632314_at:

>probe:Drosophila_2:1632314_at:663:77; Interrogation_Position=245; Antisense; AGGTCAAACTGCTAACCGGCTTGGA
>probe:Drosophila_2:1632314_at:347:371; Interrogation_Position=270; Antisense; GAAGGCCTTTCGATCGGCAAAGTCT
>probe:Drosophila_2:1632314_at:449:219; Interrogation_Position=289; Antisense; AAGTCTCTCTCGCTCATGGAGGGCA
>probe:Drosophila_2:1632314_at:125:589; Interrogation_Position=305; Antisense; TGGAGGGCATTCAGTTCGTCAGTTC
>probe:Drosophila_2:1632314_at:460:437; Interrogation_Position=343; Antisense; GAGGAGACCAAAAGAGCGCCCATTA
>probe:Drosophila_2:1632314_at:396:459; Interrogation_Position=376; Antisense; GATATTGAAGCCGTCTTGCCGAGAA
>probe:Drosophila_2:1632314_at:492:645; Interrogation_Position=389; Antisense; TCTTGCCGAGAAGTGTGGACGCCAA
>probe:Drosophila_2:1632314_at:67:485; Interrogation_Position=420; Antisense; GGTCCTAAACAACATGATCCTGAAG
>probe:Drosophila_2:1632314_at:711:193; Interrogation_Position=442; Antisense; AAGCGGGTGGGCAACTTCCTACAGG
>probe:Drosophila_2:1632314_at:270:717; Interrogation_Position=457; Antisense; TTCCTACAGGATCACACGCTACAGG
>probe:Drosophila_2:1632314_at:73:527; Interrogation_Position=537; Antisense; GGGCAACGGCGCAATGATCATGATT
>probe:Drosophila_2:1632314_at:89:231; Interrogation_Position=549; Antisense; AATGATCATGATTCCCCTTCTGCTT
>probe:Drosophila_2:1632314_at:335:169; Interrogation_Position=624; Antisense; AAAGGCGCTGATTGTGTCCAAGCTG
>probe:Drosophila_2:1632314_at:683:287; Interrogation_Position=658; Antisense; CTGGCCTCGATCATCGGAATCAAGA

Paste this into a BLAST search page for me
AGGTCAAACTGCTAACCGGCTTGGAGAAGGCCTTTCGATCGGCAAAGTCTAAGTCTCTCTCGCTCATGGAGGGCATGGAGGGCATTCAGTTCGTCAGTTCGAGGAGACCAAAAGAGCGCCCATTAGATATTGAAGCCGTCTTGCCGAGAATCTTGCCGAGAAGTGTGGACGCCAAGGTCCTAAACAACATGATCCTGAAGAAGCGGGTGGGCAACTTCCTACAGGTTCCTACAGGATCACACGCTACAGGGGGCAACGGCGCAATGATCATGATTAATGATCATGATTCCCCTTCTGCTTAAAGGCGCTGATTGTGTCCAAGCTGCTGGCCTCGATCATCGGAATCAAGA

Full Affymetrix probeset data:

Annotations for 1632314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720