FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632316_at:

>probe:Drosophila_2:1632316_at:263:555; Interrogation_Position=1001; Antisense; GGACCCCTCATTTTCAAGGACATTG
>probe:Drosophila_2:1632316_at:566:99; Interrogation_Position=1031; Antisense; AGAGGCTTCTGGATGACTCGCTGGT
>probe:Drosophila_2:1632316_at:424:147; Interrogation_Position=1065; Antisense; ACTACAGTTCACCAGAGCGTTCGAA
>probe:Drosophila_2:1632316_at:538:129; Interrogation_Position=1143; Antisense; ACCATGAGATGGTGCCCTTGGCAAA
>probe:Drosophila_2:1632316_at:483:275; Interrogation_Position=1192; Antisense; CTTGAGCTTCAAGGGATTCACCGGC
>probe:Drosophila_2:1632316_at:508:447; Interrogation_Position=1246; Antisense; GATGCGTAACTCGAGGCTAAGCCTG
>probe:Drosophila_2:1632316_at:456:339; Interrogation_Position=1261; Antisense; GCTAAGCCTGCTGTTTATTTACATA
>probe:Drosophila_2:1632316_at:292:409; Interrogation_Position=761; Antisense; GACCGCCCAGAAATTGCCGAATTGA
>probe:Drosophila_2:1632316_at:628:97; Interrogation_Position=789; Antisense; AGATGCTGCAGTGCCTGGGAGCCAC
>probe:Drosophila_2:1632316_at:591:593; Interrogation_Position=804; Antisense; TGGGAGCCACCGAGGTCCTAACAGA
>probe:Drosophila_2:1632316_at:329:717; Interrogation_Position=837; Antisense; TTCGCACCAGTGACATCTTCAAGTC
>probe:Drosophila_2:1632316_at:572:353; Interrogation_Position=864; Antisense; GCAAGTTGAAAAAGCCCCGTCTGGC
>probe:Drosophila_2:1632316_at:358:287; Interrogation_Position=884; Antisense; CTGGCCTTCAACTGTGTGGGCGGAA
>probe:Drosophila_2:1632316_at:208:549; Interrogation_Position=919; Antisense; GGAGGTGTCGCGTCATCTAGACAAT

Paste this into a BLAST search page for me
GGACCCCTCATTTTCAAGGACATTGAGAGGCTTCTGGATGACTCGCTGGTACTACAGTTCACCAGAGCGTTCGAAACCATGAGATGGTGCCCTTGGCAAACTTGAGCTTCAAGGGATTCACCGGCGATGCGTAACTCGAGGCTAAGCCTGGCTAAGCCTGCTGTTTATTTACATAGACCGCCCAGAAATTGCCGAATTGAAGATGCTGCAGTGCCTGGGAGCCACTGGGAGCCACCGAGGTCCTAACAGATTCGCACCAGTGACATCTTCAAGTCGCAAGTTGAAAAAGCCCCGTCTGGCCTGGCCTTCAACTGTGTGGGCGGAAGGAGGTGTCGCGTCATCTAGACAAT

Full Affymetrix probeset data:

Annotations for 1632316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720