Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632317_at:

>probe:Drosophila_2:1632317_at:636:521; Interrogation_Position=2150; Antisense; GGGCTTTCATTTGGCAATCCCTTAA
>probe:Drosophila_2:1632317_at:99:235; Interrogation_Position=2165; Antisense; AATCCCTTAATCAGAGAACTCCAGA
>probe:Drosophila_2:1632317_at:286:421; Interrogation_Position=2178; Antisense; GAGAACTCCAGACCGAAAGGCACCG
>probe:Drosophila_2:1632317_at:166:393; Interrogation_Position=2192; Antisense; GAAAGGCACCGGACACTCAGTACAC
>probe:Drosophila_2:1632317_at:426:257; Interrogation_Position=2288; Antisense; CACACAAACATCTCATACCCATAAA
>probe:Drosophila_2:1632317_at:436:181; Interrogation_Position=2323; Antisense; AAAAACCACTGTACACCGATGCACT
>probe:Drosophila_2:1632317_at:699:443; Interrogation_Position=2340; Antisense; GATGCACTCGTCTGCTAAATGGAAA
>probe:Drosophila_2:1632317_at:582:601; Interrogation_Position=2456; Antisense; TGTATGTCCACAGAGCGCACAGTTG
>probe:Drosophila_2:1632317_at:168:153; Interrogation_Position=2474; Antisense; ACAGTTGGCTTGGTGGAAGGACCTC
>probe:Drosophila_2:1632317_at:353:371; Interrogation_Position=2489; Antisense; GAAGGACCTCATCCTATTTTCGATC
>probe:Drosophila_2:1632317_at:10:17; Interrogation_Position=2504; Antisense; ATTTTCGATCCACGATCAGCTGCTG
>probe:Drosophila_2:1632317_at:657:331; Interrogation_Position=2525; Antisense; GCTGTGTCCCATATGTTTCGTTTAA
>probe:Drosophila_2:1632317_at:371:125; Interrogation_Position=2560; Antisense; AGCCCATAACTACTGTCTAGCTTAG
>probe:Drosophila_2:1632317_at:296:487; Interrogation_Position=2637; Antisense; GTAGCTACGTTGATACAGCATGTAA

Paste this into a BLAST search page for me
GGGCTTTCATTTGGCAATCCCTTAAAATCCCTTAATCAGAGAACTCCAGAGAGAACTCCAGACCGAAAGGCACCGGAAAGGCACCGGACACTCAGTACACCACACAAACATCTCATACCCATAAAAAAAACCACTGTACACCGATGCACTGATGCACTCGTCTGCTAAATGGAAATGTATGTCCACAGAGCGCACAGTTGACAGTTGGCTTGGTGGAAGGACCTCGAAGGACCTCATCCTATTTTCGATCATTTTCGATCCACGATCAGCTGCTGGCTGTGTCCCATATGTTTCGTTTAAAGCCCATAACTACTGTCTAGCTTAGGTAGCTACGTTGATACAGCATGTAA

Full Affymetrix probeset data:

Annotations for 1632317_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime