FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632318_at:

>probe:Drosophila_2:1632318_at:96:259; Interrogation_Position=3055; Antisense; CACATTTCAGTTGCGGAGGCTCCAT
>probe:Drosophila_2:1632318_at:94:439; Interrogation_Position=3165; Antisense; GAGGACACTCACACAACAACTCAGA
>probe:Drosophila_2:1632318_at:386:245; Interrogation_Position=3220; Antisense; AATTCTTAAGCTTCGCATTCTTTCG
>probe:Drosophila_2:1632318_at:634:11; Interrogation_Position=3236; Antisense; ATTCTTTCGATGTGTTCCTTGCTCT
>probe:Drosophila_2:1632318_at:504:275; Interrogation_Position=3253; Antisense; CTTGCTCTCGTAGTTCTTCAACGAT
>probe:Drosophila_2:1632318_at:614:137; Interrogation_Position=3273; Antisense; ACGATTACTCCTTAGTTGAGAGCGA
>probe:Drosophila_2:1632318_at:402:543; Interrogation_Position=3315; Antisense; GGATATGTTTCCAGTGTTCCGCACA
>probe:Drosophila_2:1632318_at:214:179; Interrogation_Position=3341; Antisense; AAAACAGAACGCATTTCGAGGAGAC
>probe:Drosophila_2:1632318_at:161:179; Interrogation_Position=3409; Antisense; AAACTCGATGATTTGGCGCCTTGCA
>probe:Drosophila_2:1632318_at:565:727; Interrogation_Position=3421; Antisense; TTGGCGCCTTGCATTTAAGACGACA
>probe:Drosophila_2:1632318_at:86:659; Interrogation_Position=3436; Antisense; TAAGACGACAACACACACAGCACAC
>probe:Drosophila_2:1632318_at:207:33; Interrogation_Position=3530; Antisense; ATAATCCTGTATTACCATGTCGGTG
>probe:Drosophila_2:1632318_at:149:681; Interrogation_Position=3579; Antisense; TATATATAAACCTGTACCCGCGTAC
>probe:Drosophila_2:1632318_at:46:329; Interrogation_Position=3598; Antisense; GCGTACACTCACTCGGCATACGATA

Paste this into a BLAST search page for me
CACATTTCAGTTGCGGAGGCTCCATGAGGACACTCACACAACAACTCAGAAATTCTTAAGCTTCGCATTCTTTCGATTCTTTCGATGTGTTCCTTGCTCTCTTGCTCTCGTAGTTCTTCAACGATACGATTACTCCTTAGTTGAGAGCGAGGATATGTTTCCAGTGTTCCGCACAAAAACAGAACGCATTTCGAGGAGACAAACTCGATGATTTGGCGCCTTGCATTGGCGCCTTGCATTTAAGACGACATAAGACGACAACACACACAGCACACATAATCCTGTATTACCATGTCGGTGTATATATAAACCTGTACCCGCGTACGCGTACACTCACTCGGCATACGATA

Full Affymetrix probeset data:

Annotations for 1632318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720