FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632319_at:

>probe:Drosophila_2:1632319_at:637:39; Interrogation_Position=119; Antisense; ATCTGGAGTCGGAGGAACTCTGGAC
>probe:Drosophila_2:1632319_at:444:93; Interrogation_Position=14; Antisense; AGTTGCGAAACGTTGCTCGAGTCTC
>probe:Drosophila_2:1632319_at:250:415; Interrogation_Position=151; Antisense; GAGAATGGTCCCGAGAACAACGAGG
>probe:Drosophila_2:1632319_at:303:207; Interrogation_Position=193; Antisense; AAGCGGGCCAAGTTCTTGATTCTCT
>probe:Drosophila_2:1632319_at:355:725; Interrogation_Position=208; Antisense; TTGATTCTCTGCCTGATCGAGACCA
>probe:Drosophila_2:1632319_at:102:451; Interrogation_Position=222; Antisense; GATCGAGACCAAGTTGTGCCAATTC
>probe:Drosophila_2:1632319_at:550:505; Interrogation_Position=237; Antisense; GTGCCAATTCATGGTCAGCATCCGC
>probe:Drosophila_2:1632319_at:704:355; Interrogation_Position=260; Antisense; GCACGGCTCGGGATCTGTGGAATTA
>probe:Drosophila_2:1632319_at:437:595; Interrogation_Position=275; Antisense; TGTGGAATTACTTGCGCACCCAGCA
>probe:Drosophila_2:1632319_at:16:283; Interrogation_Position=29; Antisense; CTCGAGTCTCGGAGATGGCACTGCA
>probe:Drosophila_2:1632319_at:141:355; Interrogation_Position=290; Antisense; GCACCCAGCATTCGCTGCGTTAAAG
>probe:Drosophila_2:1632319_at:331:451; Interrogation_Position=329; Antisense; GATCAGTTTCAGTCCATTGTATTAC
>probe:Drosophila_2:1632319_at:5:539; Interrogation_Position=76; Antisense; GGTTTGGACAACTACAAGGCCTGGT
>probe:Drosophila_2:1632319_at:201:665; Interrogation_Position=88; Antisense; TACAAGGCCTGGTCGATGACGGTGC

Paste this into a BLAST search page for me
ATCTGGAGTCGGAGGAACTCTGGACAGTTGCGAAACGTTGCTCGAGTCTCGAGAATGGTCCCGAGAACAACGAGGAAGCGGGCCAAGTTCTTGATTCTCTTTGATTCTCTGCCTGATCGAGACCAGATCGAGACCAAGTTGTGCCAATTCGTGCCAATTCATGGTCAGCATCCGCGCACGGCTCGGGATCTGTGGAATTATGTGGAATTACTTGCGCACCCAGCACTCGAGTCTCGGAGATGGCACTGCAGCACCCAGCATTCGCTGCGTTAAAGGATCAGTTTCAGTCCATTGTATTACGGTTTGGACAACTACAAGGCCTGGTTACAAGGCCTGGTCGATGACGGTGC

Full Affymetrix probeset data:

Annotations for 1632319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720