Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632322_at:

>probe:Drosophila_2:1632322_at:54:703; Interrogation_Position=2050; Antisense; TTATTATTTGTATGCGCACTCTTCG
>probe:Drosophila_2:1632322_at:279:355; Interrogation_Position=2065; Antisense; GCACTCTTCGTGCTTTAGTCATTTT
>probe:Drosophila_2:1632322_at:459:497; Interrogation_Position=2082; Antisense; GTCATTTTCTTGTTGTACACCAGCA
>probe:Drosophila_2:1632322_at:247:475; Interrogation_Position=2192; Antisense; GTTACCATTGTAATCATCTCCTTTG
>probe:Drosophila_2:1632322_at:654:35; Interrogation_Position=2207; Antisense; ATCTCCTTTGAACATTACGCACACA
>probe:Drosophila_2:1632322_at:544:157; Interrogation_Position=2227; Antisense; ACACACTTGCTCATCGATGGCCAAA
>probe:Drosophila_2:1632322_at:712:491; Interrogation_Position=2259; Antisense; GTAACAAGCATCCATTGGACCGCAA
>probe:Drosophila_2:1632322_at:326:555; Interrogation_Position=2275; Antisense; GGACCGCAATCAGTTCCAGGATTTG
>probe:Drosophila_2:1632322_at:652:381; Interrogation_Position=2301; Antisense; GAACGCAACTGCAGATCCCTTTGGA
>probe:Drosophila_2:1632322_at:289:491; Interrogation_Position=2379; Antisense; GTACACCTAACTTATGCATGGCGAC
>probe:Drosophila_2:1632322_at:134:403; Interrogation_Position=2401; Antisense; GACTTGCTCGTCGTGAGGAGTTACA
>probe:Drosophila_2:1632322_at:93:543; Interrogation_Position=2448; Antisense; GGATTGTATCCCTTGTATCGTGATC
>probe:Drosophila_2:1632322_at:239:685; Interrogation_Position=2463; Antisense; TATCGTGATCGAATTCTCTGACAAA
>probe:Drosophila_2:1632322_at:577:187; Interrogation_Position=2508; Antisense; AACACGCGCGACACAAATATTCATT

Paste this into a BLAST search page for me
TTATTATTTGTATGCGCACTCTTCGGCACTCTTCGTGCTTTAGTCATTTTGTCATTTTCTTGTTGTACACCAGCAGTTACCATTGTAATCATCTCCTTTGATCTCCTTTGAACATTACGCACACAACACACTTGCTCATCGATGGCCAAAGTAACAAGCATCCATTGGACCGCAAGGACCGCAATCAGTTCCAGGATTTGGAACGCAACTGCAGATCCCTTTGGAGTACACCTAACTTATGCATGGCGACGACTTGCTCGTCGTGAGGAGTTACAGGATTGTATCCCTTGTATCGTGATCTATCGTGATCGAATTCTCTGACAAAAACACGCGCGACACAAATATTCATT

Full Affymetrix probeset data:

Annotations for 1632322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime