FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632324_at:

>probe:Drosophila_2:1632324_at:495:267; Interrogation_Position=1991; Antisense; CATAATGGGTGCTCCGGACGGATCG
>probe:Drosophila_2:1632324_at:506:407; Interrogation_Position=2081; Antisense; GACGGAGTTGTTGCAGAACGCCTTC
>probe:Drosophila_2:1632324_at:96:83; Interrogation_Position=2095; Antisense; AGAACGCCTTCGAGCTGTACGGTTG
>probe:Drosophila_2:1632324_at:124:601; Interrogation_Position=2110; Antisense; TGTACGGTTGCGACTTCATGCTCGA
>probe:Drosophila_2:1632324_at:261:259; Interrogation_Position=2139; Antisense; CACTACAATCCCATTCTGATCGAGA
>probe:Drosophila_2:1632324_at:558:425; Interrogation_Position=2160; Antisense; GAGATCAACTCGACGCCGGATTTGT
>probe:Drosophila_2:1632324_at:268:543; Interrogation_Position=2177; Antisense; GGATTTGTCGCCATCCACGGAGATC
>probe:Drosophila_2:1632324_at:443:649; Interrogation_Position=2200; Antisense; TCACGGCCAGGATATGTCCGATGGT
>probe:Drosophila_2:1632324_at:59:631; Interrogation_Position=2239; Antisense; TCCGCGTGGTGGTGGATCTGCCCAA
>probe:Drosophila_2:1632324_at:39:633; Interrogation_Position=2296; Antisense; TCGCCTTCGAGGTGAACTACAGCAT
>probe:Drosophila_2:1632324_at:439:53; Interrogation_Position=2367; Antisense; ATGACCCTGTTCGAAAATATGCCCA
>probe:Drosophila_2:1632324_at:159:25; Interrogation_Position=2383; Antisense; ATATGCCCAGAATGCGGAACAGCCC
>probe:Drosophila_2:1632324_at:520:571; Interrogation_Position=2416; Antisense; GGCTCCTGCGCAAGATTCTGAACAA
>probe:Drosophila_2:1632324_at:577:509; Interrogation_Position=2499; Antisense; GTGAAGAATCCCACTGCCAAGATCA

Paste this into a BLAST search page for me
CATAATGGGTGCTCCGGACGGATCGGACGGAGTTGTTGCAGAACGCCTTCAGAACGCCTTCGAGCTGTACGGTTGTGTACGGTTGCGACTTCATGCTCGACACTACAATCCCATTCTGATCGAGAGAGATCAACTCGACGCCGGATTTGTGGATTTGTCGCCATCCACGGAGATCTCACGGCCAGGATATGTCCGATGGTTCCGCGTGGTGGTGGATCTGCCCAATCGCCTTCGAGGTGAACTACAGCATATGACCCTGTTCGAAAATATGCCCAATATGCCCAGAATGCGGAACAGCCCGGCTCCTGCGCAAGATTCTGAACAAGTGAAGAATCCCACTGCCAAGATCA

Full Affymetrix probeset data:

Annotations for 1632324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720