FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632325_at:

>probe:Drosophila_2:1632325_at:147:103; Interrogation_Position=2909; Antisense; AGAGCCCCAGGTCGATGCCATTGGC
>probe:Drosophila_2:1632325_at:395:633; Interrogation_Position=2935; Antisense; TCCCCAAGGAGATCAGCTTCCAGGA
>probe:Drosophila_2:1632325_at:695:431; Interrogation_Position=2958; Antisense; GAGTCCGGCGACAGGATCTCAGCAG
>probe:Drosophila_2:1632325_at:383:201; Interrogation_Position=2997; Antisense; AACCATTAGCCCCTATGACGAGAGT
>probe:Drosophila_2:1632325_at:584:133; Interrogation_Position=3014; Antisense; ACGAGAGTCCGCAGTCAAAGTTCCT
>probe:Drosophila_2:1632325_at:259:255; Interrogation_Position=3029; Antisense; CAAAGTTCCTCAAATACACGGAGCT
>probe:Drosophila_2:1632325_at:85:555; Interrogation_Position=3048; Antisense; GGAGCTGGCCAAACAGCTATCCTCT
>probe:Drosophila_2:1632325_at:61:155; Interrogation_Position=3060; Antisense; ACAGCTATCCTCTAAAAACGCCTAA
>probe:Drosophila_2:1632325_at:568:175; Interrogation_Position=3075; Antisense; AAACGCCTAAACTGCTGAAGAACGG
>probe:Drosophila_2:1632325_at:436:727; Interrogation_Position=3191; Antisense; TTGGGTCACAGATTGCAGACACGTA
>probe:Drosophila_2:1632325_at:3:365; Interrogation_Position=3234; Antisense; GAATTTATCCTTTGGACTGAGGCTA
>probe:Drosophila_2:1632325_at:570:245; Interrogation_Position=3265; Antisense; AATTGTTCATTTTACGAAGCCGACT
>probe:Drosophila_2:1632325_at:476:369; Interrogation_Position=3280; Antisense; GAAGCCGACTGTTTAACGGTCGTAT
>probe:Drosophila_2:1632325_at:144:543; Interrogation_Position=3385; Antisense; GGATACTTTCGTCGATGCCTGTTAA

Paste this into a BLAST search page for me
AGAGCCCCAGGTCGATGCCATTGGCTCCCCAAGGAGATCAGCTTCCAGGAGAGTCCGGCGACAGGATCTCAGCAGAACCATTAGCCCCTATGACGAGAGTACGAGAGTCCGCAGTCAAAGTTCCTCAAAGTTCCTCAAATACACGGAGCTGGAGCTGGCCAAACAGCTATCCTCTACAGCTATCCTCTAAAAACGCCTAAAAACGCCTAAACTGCTGAAGAACGGTTGGGTCACAGATTGCAGACACGTAGAATTTATCCTTTGGACTGAGGCTAAATTGTTCATTTTACGAAGCCGACTGAAGCCGACTGTTTAACGGTCGTATGGATACTTTCGTCGATGCCTGTTAA

Full Affymetrix probeset data:

Annotations for 1632325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720