FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632326_at:

>probe:Drosophila_2:1632326_at:104:157; Interrogation_Position=170; Antisense; ACACGTGAAGCAACCGAATTCGGCA
>probe:Drosophila_2:1632326_at:377:153; Interrogation_Position=194; Antisense; ACAGGAATCCTGACGAACGCCTTGC
>probe:Drosophila_2:1632326_at:151:275; Interrogation_Position=214; Antisense; CTTGCGCGGATTTCCTTTAATGGGA
>probe:Drosophila_2:1632326_at:3:77; Interrogation_Position=259; Antisense; AGGATACTGCGGATTAGTTCTGCAA
>probe:Drosophila_2:1632326_at:592:153; Interrogation_Position=287; Antisense; ACAGAGAAGCCCATCAGCGATACCT
>probe:Drosophila_2:1632326_at:641:113; Interrogation_Position=302; Antisense; AGCGATACCTCCGACCGAAAGTTGC
>probe:Drosophila_2:1632326_at:166:333; Interrogation_Position=322; Antisense; GTTGCGGCTAACTGGAGTATTTCAA
>probe:Drosophila_2:1632326_at:180:363; Interrogation_Position=347; Antisense; GATTTTACTTACTGGAACTACGACA
>probe:Drosophila_2:1632326_at:577:397; Interrogation_Position=368; Antisense; GACAAAGTGCCGTCCAATGGCGATC
>probe:Drosophila_2:1632326_at:571:547; Interrogation_Position=418; Antisense; GGATGTTGCTCAAGCTCTCTCGCAG
>probe:Drosophila_2:1632326_at:236:261; Interrogation_Position=440; Antisense; CAGCCCATTAGCGAAGAGGATTTAG
>probe:Drosophila_2:1632326_at:279:145; Interrogation_Position=505; Antisense; CACGTAGTTTTGTTTTAATCGCGCT
>probe:Drosophila_2:1632326_at:415:671; Interrogation_Position=530; Antisense; TACCGCGTTCTATTTATTACTCCAA
>probe:Drosophila_2:1632326_at:443:5; Interrogation_Position=93; Antisense; ATTTAGACGTGCACTACTTGCCGGC

Paste this into a BLAST search page for me
ACACGTGAAGCAACCGAATTCGGCAACAGGAATCCTGACGAACGCCTTGCCTTGCGCGGATTTCCTTTAATGGGAAGGATACTGCGGATTAGTTCTGCAAACAGAGAAGCCCATCAGCGATACCTAGCGATACCTCCGACCGAAAGTTGCGTTGCGGCTAACTGGAGTATTTCAAGATTTTACTTACTGGAACTACGACAGACAAAGTGCCGTCCAATGGCGATCGGATGTTGCTCAAGCTCTCTCGCAGCAGCCCATTAGCGAAGAGGATTTAGCACGTAGTTTTGTTTTAATCGCGCTTACCGCGTTCTATTTATTACTCCAAATTTAGACGTGCACTACTTGCCGGC

Full Affymetrix probeset data:

Annotations for 1632326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720