FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632327_at:

>probe:Drosophila_2:1632327_at:32:217; Interrogation_Position=1150; Antisense; AAGTTCTAAGCCATAGGGCACCGCC
>probe:Drosophila_2:1632327_at:639:525; Interrogation_Position=1165; Antisense; GGGCACCGCCATTAAAATTTGTCAT
>probe:Drosophila_2:1632327_at:344:359; Interrogation_Position=659; Antisense; GCAACAATGTCTACTCAGAGCGCGT
>probe:Drosophila_2:1632327_at:537:255; Interrogation_Position=674; Antisense; CAGAGCGCGTAAAGTTGACCAACCA
>probe:Drosophila_2:1632327_at:709:203; Interrogation_Position=694; Antisense; AACCACATGAAAGTCCACAGCGCGA
>probe:Drosophila_2:1632327_at:364:163; Interrogation_Position=737; Antisense; AAATCTGTCACAAACGTTTTCGCCA
>probe:Drosophila_2:1632327_at:272:633; Interrogation_Position=765; Antisense; TCCGCAGTTGGCGAGGCACATGAAC
>probe:Drosophila_2:1632327_at:107:131; Interrogation_Position=796; Antisense; ACCGGTAATCGTCCCTACAAATGTG
>probe:Drosophila_2:1632327_at:531:229; Interrogation_Position=815; Antisense; AATGTGACTATTGCGACTCCAGGTT
>probe:Drosophila_2:1632327_at:273:347; Interrogation_Position=864; Antisense; GCATCAGAGGATCCACACCAACGAA
>probe:Drosophila_2:1632327_at:633:255; Interrogation_Position=897; Antisense; CAAATGCGAGTTCTGCAGCAGGTCC
>probe:Drosophila_2:1632327_at:652:469; Interrogation_Position=946; Antisense; GTTCATCTGAAAACCCATACCGGTG
>probe:Drosophila_2:1632327_at:707:509; Interrogation_Position=968; Antisense; GTGAACGACCATTTAGCTGCCAGTA
>probe:Drosophila_2:1632327_at:246:705; Interrogation_Position=980; Antisense; TTAGCTGCCAGTACTGCCAGAAGTC

Paste this into a BLAST search page for me
AAGTTCTAAGCCATAGGGCACCGCCGGGCACCGCCATTAAAATTTGTCATGCAACAATGTCTACTCAGAGCGCGTCAGAGCGCGTAAAGTTGACCAACCAAACCACATGAAAGTCCACAGCGCGAAAATCTGTCACAAACGTTTTCGCCATCCGCAGTTGGCGAGGCACATGAACACCGGTAATCGTCCCTACAAATGTGAATGTGACTATTGCGACTCCAGGTTGCATCAGAGGATCCACACCAACGAACAAATGCGAGTTCTGCAGCAGGTCCGTTCATCTGAAAACCCATACCGGTGGTGAACGACCATTTAGCTGCCAGTATTAGCTGCCAGTACTGCCAGAAGTC

Full Affymetrix probeset data:

Annotations for 1632327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720